Single B cells were index-sorted into 96-well plates containing 5 μl TCL buffer (QIAGEN) supplemented with 1% β-mercaptoethanol. Nucleic acids were extracted using SPRI bead cleanup as described (Tas et al., 2016 (link), Trombetta et al., 2014 ). RNA was reverse-transcribed into cDNA using RT maxima reverse transcriptase (Thermo Scientific) and oligo(dT) as a primer. Ig heavy chains were amplified by PCR using a forward primer with a consensus sequence for all V-region and reverse primers for each isotype. Ig kappa light chains were amplified separately where needed to confirm clonality or for antibody production purposes. Subsequently, 5-nucleotide barcodes were introduced by PCR to label Ig-sequences with plate- and well-specific barcodes. The forward primer contained barcodes to identify the plate and row number; the reverse primers contained the column-position barcode, adapted from (Han et al., 2014 (link)). In the final PCR step, Illumina paired-end sequencing adapters were incorporated into single-well amplicons. PCR-products were pooled by plate and cleaned-up using SPRI beads (0.7x volume ratio). Finally, the pooled amplicon library was sequenced with a 500-cycle Reagent Nano kit v2 on the Illumina Miseq platform as per the manufacturer’s instructions. Primer sequences are provided in Data S3 .
Reagent nano kit v2
Manufactured by Illumina
Sourced in United States
The Reagent Nano kit v2 is a laboratory equipment product designed for sample preparation. It provides the necessary reagents and consumables for next-generation sequencing applications. The core function of the kit is to enable efficient and reliable sample processing prior to sequencing analysis.
Automatically generated - may contain errors
Lab products found in correlation
Miseq platform, by Illumina (4 mentions)
Reagent kit v3, by Illumina (3 mentions)
Paired end sequencing adapters, by Illumina (2 mentions)
Maxima rt reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Tcl buffer, by Qiagen (1 mentions)
Maxima rt, by Thermo Fisher Scientific (1 mentions)
Miseq instrument, by Illumina (1 mentions)
Nextera xt kit, by Illumina (1 mentions)
6 protocols using reagent nano kit v2
1
Single-Cell Antibody Sequencing Workflow
2
Single B Cell Ig Repertoire Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Libraries were prepared as previously described (Mesin et al., 2020 (link)). Briefly, nucleic acids were extracted from sorted single B cells and reverse transcribed into cDNA using RT maxima reverse transcription (Thermo Fisher Scientific) and oligo(dT) primer. Ig heavy chains were amplified by PCR using a consensus forward primer for all V regions and reverse primers specific for each isotype. In the next round of PCR, 5-nucleotide barcodes were introduced using forward and reverse primers to identify the plate number/row position and column position, respectively. In the last round of PCR, Illumina paired-end sequencing adapters were incorporated. PCR products were then pooled, cleaned up using SPRI beads, and sequenced using a 500-cycle Reagent Nano kit v2 on the Illumina Miseq platform according to the manufacturer’s instructions.
3
Single-Cell Immunoglobulin Profiling
4
Single-Cell Immunoglobulin Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from single cells or 100-cell pools was reverse-transcribed using oligo-dT as in11 (link),16 (link). PCR primers were used as described previously11 (link),28 with the addition of IgA-specific amplification primers Cα outer (ATCAGGCAGCCGATTATCAC) and Cα inner (GAGCTCGTGGGAGTGTCAGTG)16 (link). Pooled PCR products were then purified using SPRI beads (0.7x volume ratio), gel purified and sequenced with a 500-cycle Reagent Nano kit v2 for single cell libraries and with a 600-cycle Reagent kit v3 for 100-cell pool libraries on the Illumina Miseq platform.
5
Library Preparation and Sequencing of Human Genome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Library preparation was performed according to the TSCA protocol. The successfully produced samples were pooled and sequenced on the Illumina MiSeq instrument using the Miseq reagent nano kit v2 generating 2x150 paired-end reads at a level of 300Mb output. The reads were aligned to the human (Homo sapiens) reference sequence version GRCh37.7, which was obtained from the Ensembl database. 6 The alignments of paired-end reads were generated with the bwa-mem algorithm. Duplicated reads were removed from the alignment by the Picard tool MarkDuplicates. The SAMtools 7 pipeline was used in the variant-calling process.
6
PCR Amplicons Pooling and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Equimolar amounts of the purified PCR amplicons were combined in 14 pools containing non-overlapping target regions of up to seven individual probands. The Nextera XT kit was used to prepare sequencing libraries with 1 ng of each pool (Illumina®, San Diego, USA). Individually barcoded DNA libraries were combined and sequenced on a MiSeq instrument with 2 Â 150 or 2 Â 250 cycles (Reagent Nano Kit v2 or Reagent Kit v3; Illumina®, San Diego, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!