Log In Sign up
The largest database of trusted experimental protocols

Ppicza vector

Manufactured by Thermo Fisher Scientific
Visit Supplier

The PPICZA vector is a plasmid used in molecular biology experiments. It is designed to express recombinant proteins in Escherichia coli. The vector contains a promoter, multiple cloning sites, and a selection marker, allowing researchers to clone and express their gene of interest.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (1 mentions) Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) T4 ligase, by Thermo Fisher Scientific (1 mentions) Kapa hifi polymerase, by Roche (1 mentions) Pgem vector, by Promega (1 mentions) T4 polynucleotide kinase t4 pnk, by Thermo Fisher Scientific (1 mentions) Pgem t easy vector, by Promega (1 mentions) Restriction enzyme, by New England Biolabs (1 mentions) Easyselect pichia expression kit, by Thermo Fisher Scientific (1 mentions) Cellotriose, by Megazyme (1 mentions) Glucomannan, by Megazyme (1 mentions) Cellotetraose, by Megazyme (1 mentions) Cellopentaose, by Megazyme (1 mentions) Cellohexaose, by Megazyme (1 mentions) Lichenan, by Megazyme (1 mentions) Barley β glucan, by Megazyme (1 mentions)

Spelling variants of this product

PPICZA (19 citations) PPICZa expression vector (2 citations)

3 protocols using ppicza vector

1

Cloning and Mutagenesis of Human Serum Albumin

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech) and sense (CGCGAATTCATGAAGTGGGTAACC) and antisense (CGCCTCGAGTTATAAGCCTAAGGCAGC) primers containing EcoRI and XhoI restriction sites (underlined), respectively. The amplified product was cloned into a pGEM vector (Promega), sequenced and subcloned into pPICZA vector (Invitrogen). The propeptide sequence (AGGGGTGTGTTTCGTCGA) was deleted by PCR using primers flanking the target sequence (reverse GGAATAAGCCGAGCTAAAGAGAAAAAGAAGGG and forward GATGCACACAAGAGTGAGGTTGCTCATCGG) previously phosphorylated with T4 polynucleotide kinase T4-PNK (Thermo Scientific). T4 ligase (Thermo Scientific) was used to blunt end ligate the PCR product. Domain I (DomI) coding region was obtained from the last by PCR amplification using KAPA HiFi polymerase (Kapa Biosystems) and specific sense (CGCGAATTCATGAAGTGGGTAACC) and antisense (CGCCTCGAGTTATTTGGCAGACGAAGCCTT) primers containing EcoRI and XhoI restriction sites (underlined), respectively. Then it was subcloned back into pPICZA (pPICZA-DomI).
Steglich M., Lombide R., López I., Portela M., Fló M., Marín M., Alvarez B, & Turell L. (2020). Expression, purification and initial characterization of human serum albumin domain I and its cysteine 34. PLoS ONE, 15(10), e0240580.
+ Open protocol
+ Expand
2

Recombinant Human β-Actin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Homo sapiens ACTB cDNA cloned in the pGEM-T Easy Vector (#A1360, Promega) was modified by PCR using the sense primer (GGT ACC ATG CAC CAT CAC CA TCA CCA TGA AAA CCT GTA CTT CCA ATC CAT GGA TGA TGA TAT CGC CGC G) that contains one KpnI restriction site (underlined) and a start codon followed by a 6x histidine-encoding sequence and TEV protease cleavage site; and the AgeI-containing antisense primer ACCGGTCTAGAAGCATTTGCGGTGGAC. The corresponding PCR product was digested with KpnI/AgeI and subcloned in the pPICZA vector (#V19020, Invitrogen) for expression of 6xHis-tagged human β-actin in Pichia pastoris yeast. DNA sequencing of the human ACTB construct in pPICZA (pPICZA/h-β -actin) was performed.
Hachimi M., Grabowski C., Campanario S., Herranz G., Baonza G., Serrador J., Gomez-Lopez S., Barea M.D., Bosch-Fortea M., Gilmour D., Bagnat M., Rodriguez-Fraticelli A.E, & Martin-Belmonte F. (2020). Smoothelin-like 2 inhibits Coronin-1B to stabilize the apical actin cortex during epithelial morphogenesis. Current biology : CB, 31(4), 696-706.e9.
+ Open protocol
+ Expand
3

Heterologous Protein Expression in Pichia pastoris

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pichia pastoris X-33 strain, the EasySelect™ Pichia expression Kit and pPICZA vector were purchased from Invitrogen (Carlsbad, CA). Restriction enzymes were purchased from New England Biolabs (Ipswich, Massachusetts, USA). All chemicals were of the highest purity grade available and were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless stated differently. Methanol and microcrystalline cellulose (MCC) were purchased from Merck (Kenilworth NJ, EEUU), carboxymethylcellulose sodium salt (CMC) with a degree of substitution of 0.60–0.95 was purchased from Fluka (Buchs, Switzerland), xylan (Carl Roth, Karlsruhe, Germany), glucomannan, lichenan, barley β-glucan, cellotriose, cellotetraose, cellopentaose and cellohexaose were purchased from Megazyme (Wicklow, Ireland). Kobe Agar-agar and yeast extract were purchased from Carl Roth and yeast nitrogenous base without amino acids (YNB) was obtained from VWR chemicals (Radnor, Pensylvania, USA). Phosphoric acid swollen cellulose (PASC) was prepared from MCC as described previously [19 (link)].
Amengual N.G., Csarman F., Wohlschlager L, & Ludwig R. (2022). Expression and Characterization of a Family 45 Glycosylhydrolase from Fomitopsis pinicola and comparison to Phanerochaete chrysosporium Cel45A. Enzyme and microbial technology, 156, 110000.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!