Trizol

2 × 10⁶ K562 cells were incubated with N-terminally biotinylated peptides (c(peptide) = 10 μM, t = 2.5 h) for uptake on a rotating wheel at 37°C. The cells were extensively washed in PBS and lysed in lysis buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 0.05% IGEPAL CA-630, 1 mM EDTA) supplemented with 0.5 U/μl RNAse inhibitor (Superase-in, ThermoFisher). The lysate was cleared by centrifugation at 21 000 g at 4°C, an aliquot of the supernatant was removed and re-suspended in Trizol, while the remaining was incubated with streptavidin-coupled magnetic beads (Dynabeads M280, ThermoFisher) on a rotating wheel (2 h, 4°C). After magnetic separation and washing (3× in lysis buffer), the beads were re-suspended in 20 μl lysis buffer, re-suspended in Trizol (ThermoFisher), and 400 ng t-RNA was added per sample as a carrier. RNA was extracted from Trizol using the standard protocol and the qRT-PCR was performed according to a previously published protocol (62 (link)) using the primers h-miR21-3p-FW (CAGCAACACCAGTCGATG), h-miR21-3p-RV (GGTCCAGTTTTTTTTTTTTTTTACAG), h-miR21-5p-FW (GCAGTAGCTTATCAGACTGATG), h-miR21-5p-RV (GGTCCAGTTTTTTTTTTTTTTTCAAC) in a CFX96 real-time machine (Bio-Rad). The relative enrichment was calculated as a ratio of copies in the immunoprecipitate over input normalized to the enrichment of the control peptide D1.

Mouse hepatic infection was assessed at either 30 min, 2 h, 6 h, 12 h, 24 h or 46 h after P. berghei sporozoite inoculation and quantified either by real-time in vivo imaging employing the IVIS Lumina Imaging System (Caliper LifeSciences, Waltham, MA, USA), as previously described [75 (link)], or by quantitative real-time reverse transcriptase-PCR (qRT-PCR), also as previously described [79 (link)]. P. berghei bioluminescence was measured as total flux (photons/s) and analyzed with the Living Image software (version 3.0, PerkinElmer, Waltham, MA, USA). For qRT-PCR analyses, 0.7–0.9 mg of livers collected by dissection of infected mice were mechanically homogenized in TRIzol (BioRad, Hercules, CA, USA), RNA was extracted following the manufacturer’s instructions and converted into complementary DNA (cDNA) as described below. Liver P. berghei load was quantified by qRT-PCR, as previously described [80 (link)], using primers specific for P. berghei 18S rNA (Table 1). Expression of the endogenous mouse housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt) was used for normalization.

Mouse liver infection by Plasmodium was assessed 46 h after sporozoite inoculation and quantified by quantitative real-time reverse transcriptase-PCR (qRT-PCR), as previously described[40 (link)]. For qRT-PCR analyses, 0.7–0.9 mg of livers collected upon euthanasia of infected mice were mechanically homogenized in TRIzol (BioRad, Hercules, CA, USA), RNA was extracted following the manufacturer’s instructions, and converted into complementary DNA (cDNA) as described below. Liver Plasmodium load was quantified by qRT-PCR, as previously described[41 (link)], using primers specific for Plasmodium 18S rRNA (Table 1). Expression of the endogenous mouse housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt) was used for normalization.