Lr clonase 2 plus enzyme mix

Transgenes encoding fusions with the protein G/streptavidin-binding peptide GS and GFP under control of the constitutive cauliflower tobacco mosaic virus 35S promoter (CaMV-35S) were cloned by means of Gateway recombination (Thermo Fisher Scientific). The ORFs of MAX2, MAX2ΔFBOX, D14, KAI2, PAPP5 (splice variant AT2G42810.1), and the MAX2 promoter region (pMAX2, 2031 bp) were amplified from Arabidopsis cDNA with iProof High-Fidelity DNA Polymerase (Bio-Rad) and Gateway-specific primers (see supplemental Table S1). For the construction of the modified version of MAX2 (hereafter designated MAX2ΔFBOX), the first 159 nucleotides were deleted. The attB site-flanked PCR product was cloned into pDONR207 (ORF) or pDONRP4-P1R (pMAX2) with the BP Clonase II enzyme mix (Invitrogen). The entry vectors were subsequently cloned with the LR Clonase II Plus enzyme mix (Invitrogen) into the destination vectors pKNTAP for N-terminal GS fusions (42 (link)) or into pK7m34GW for the N- and C-terminal GFP fusions. The obtained expression clones were transformed to the Agrobacterium tumefaciens strain C58C1Rif^R (pMP90) by electroporation.

C. reflexa plants were grown under long day conditions (16 h day/8 h night) at 22 °C, in a greenhouse. Genomic DNA was extracted from frozen tissue using the Plant DNA Preparation Kit (Jena Biosciences, Germany), and PCR was performed with gene specific primers for the candidate gene (C_ref_ r2_000247) CrGRP): FW: ATGAGTTCAAGGGTCTTTCTTCTCC, REV: AGGCTTCGTCGCATCAATGGC; The PCR products were cloned to the pCR8/GW/TOPO TA-cloning vector (Invitrogen™, Thermo Fisher). Reverse primers without stop codon allowed for C-terminal fusion to a GFP tag after recombining via LR-reaction (LR-clonase® II Plus enzyme mix, Invitrogen™) into respective vectors (pB7FWG2.0, pK7FWG2.0, both with C-terminal GFP tag; plant systems biology, university of Gent). For cloning of a CrGRP cDNA construct, total RNA was extracted from tomato plants (RNeasy Plant Mini Kit, Quiagen), and cDNA was synthesized by reverse transcription (First-Strand cDNA Synthesis Kit, GE Healthcare Life Sciences); PCR was performed with primers above. For subcellular localization, CrGRP has been cloned via LR-reaction into a modified version of pGWB660, including a tagRFP^{28 (link)}.

For all TAP constructs, cloning was performed by means of Gateway^® recombination (Thermo Fisher Scientific). The open reading frame (ORF) of SMXL7 was amplified from Arabidopsis cDNA with iProof^TM High-Fidelity DNA Polymerase (Bio-Rad) and Gateway^®-specific primers. The PCR product flanked with attB sites was cloned in pDONR207 with the BP Clonase^® II enzyme mix (Invitrogen). The resulting entry vector was used to clone the bait into the destination vector pKNGS-rhino and pKCTAP for N- and C-terminal fusions, respectively, under the control of the 35S promoter (Van Leene et al., 2015 (link)) with the LR Clonase^® II Plus enzyme mix (Invitrogen). For the construction of the modified version of SMXL7 (hereafter designated ΔSMXL7), the Arg (R) at amino acid position 719 of the pDONR207-SMXL7 was mutated into a Thr (T), and the next five amino acids were deleted with the Spliced Overlap Extension PCR (SOE-PCR) (Higuchi et al., 1988 (link)). After sequence confirmation, the cloning steps were done in the same manner as for SMXL7. All primers used for cloning are listed in Supplementary Table 1.

Mouse RNF183 and RNF152 constructs, with or without a stop codon, were cloned into the pENTR-D-TOPO vector (Invitrogen). For stable V5-tagged protein expression, the entry clone product and pENTR5’/CMVp vector (Invitrogen) were recombined into the pLenti 6.4/R4R2/V5-DEST vector (Invitrogen) using LR Clonase II Plus enzyme mix (Invitrogen). To produce lentivirus particles expressing V5-tagged mouse RNF183 or RNF152, the pLenti-based expression vector and ViraPower Packaging mix (Invitrogen) were cotransfected into the 293FT cell line. Virus-containing supernatants were harvested, and viral particles were transduced into HEK293 cells. Cells exhibiting stable RNF183 or RNF152 expression were selected using 5 μg/ml blasticidin S hydrochloride (Wako Pure Chemical Industries, Osaka, Japan). The HRD1 stable cell line has been described previously [5 (link)].
Human Sec16A sequence was cloned into pENTR-3C Dual Selection Vector (Invitrogen) as an entry clone. For the expression of N-terminal EmGFP-tag, the entry clone product was recombined into Vivid Colors pcDNA6.2/EmGFP-DEST Gateway Vector (Invitrogen) using LR recombination reaction. Sec16A deletion domain constructs were generated by inverse PCR using the entry clone product.