Azcl xylan
AZCL-xylan is a chromogenic substrate used for the detection and measurement of xylanase enzyme activity. It is composed of azure-dyed, cross-linked xylan that is insoluble in water. Xylanase enzymes hydrolyze the xylan backbone, releasing the azure dye, which can be measured spectrophotometrically.
Lab products found in correlation
3 protocols using azcl xylan
Enzymatic Assay of Glycan Hydrolysis
Screening Yeast Endo-Xylanase Activity
For each sample, several yeast colonies positive for endo-xylanase activity were picked, lysed at 95°C for 10 min in 3 µl of 20 mM NaOH and the pDR196 insert amplified by PCR using primers PMA1 and ADH (GCGAATTTCTTATGATTTATG). PCR products were sequenced by BIOFIDAL using the PMA1 primer.
Screening for Xylanase Activity
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!