AZCL-galactomannan and AZCL-xylan substrates (Megazyme) were suspended in 0.3 M MES pH 5.8 (5 mg mL−1). To 100 μL substrate, 20 μL protein extract was added and incubated at 28 °C overnight, in triplicate reactions. Assays were stopped by the addition of 3% Tris solution (150 μL, un-pHed) after incubation, and centrifuged (10 min at 11,000 xg). Supernatants (150 μL) were transferred to microtitre plates and absorbance measured at 590 nm. For background reactions, Tris was added to assays prior to enzyme extract and values subtracted from values gained using active enzyme extract. Enzyme activities were expressed as relative OD at 590 nm per g fresh weight.
Azcl xylan
Manufactured by Megazyme
AZCL-xylan is a chromogenic substrate used for the detection and measurement of xylanase enzyme activity. It is composed of azure-dyed, cross-linked xylan that is insoluble in water. Xylanase enzymes hydrolyze the xylan backbone, releasing the azure dye, which can be measured spectrophotometrically.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using azcl xylan
1
Enzymatic Assay of Glycan Hydrolysis
2
Screening Yeast Endo-Xylanase Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each cDNA sample, a minimum of 2,000 independent kanamycin-resistant transformed E. coli colonies were pooled together for plasmid extraction using the alkaline lysis method.37 Aliquot samples of each plasmid library were used to transform the S. cerevisiae strain DSY-5 (MATα leu2 trp1 ura3-52 his3::PGAL1-GAL4 pep4 prb1-1122; Dualsystems Biotech) using a standard lithium acetate protocol.38 Transformed yeasts were selected on a solid yeast nitrogen base (YNB) minimal medium supplemented with glucose (2%) and amino acids, but lacking uracil. YNB agar plates were overlaid by a thin layer of the same medium containing 4 mg l−1 of AZCL-xylan (Megazyme), a substrate specific for endo-xylanases. Plates were incubated at 30°C. Yeast colonies producing a secreted endo-xylanase were surrounded by a dark blue halo resulting from the hydrolysis of AZCL-xylan.
For each sample, several yeast colonies positive for endo-xylanase activity were picked, lysed at 95°C for 10 min in 3 µl of 20 mM NaOH and the pDR196 insert amplified by PCR using primers PMA1 and ADH (GCGAATTTCTTATGATTTATG). PCR products were sequenced by BIOFIDAL using the PMA1 primer.
For each sample, several yeast colonies positive for endo-xylanase activity were picked, lysed at 95°C for 10 min in 3 µl of 20 mM NaOH and the pDR196 insert amplified by PCR using primers PMA1 and ADH (GCGAATTTCTTATGATTTATG). PCR products were sequenced by BIOFIDAL using the PMA1 primer.
3
Screening for Xylanase Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The functional screen for xylanase activity was conducted on LB-agar plates containing 0.1% (w/v) Azurin-crosslinked xylan from oat spelt (AZCL-xylan, Megazyme). For the screening of the fosmid libraries, Copycontrol Fosmid Autoinduction Solution (Epicentre, USA) was added to screening plates in order to increase assay sensitivity. The screen was conducted at tenfold coverage of each primary library clone number to provide the maximal amount of unique xylanase-positive clones. E. coli clones surrounded by blue halos were picked, repeat plated and unique clones isolated using restriction analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!