Pgipz lentiviral shrnamir vectors

To knockdown STMN-1 expression, pGIPZ-lentiviral shRNAmir vectors targeting human STMN1 and Non-silencing pGIPZ control vector were purchased from Open Biosystems (Thermo Fisher Scientific, Inc.). The sequences of STMN-1 shRNA are as following: 5′-TTATTAGCTTCCATTTTGT-3′; 5′-TCTCTTCTATTGCCTTCTG-3′ and 5′-TTATTAACCATTCAAGTCC-3′. Lentiviral shRNA was produced by Co-transfection of the Trans-Lentiviral packaging mix with a shRNA transfer vector into HEK293T packaging cells (OpenBiosystems). For cell infection, viral supernatants were supplemented with 6 μg/mL polybrene and incubated with cells for 24 hours. Esophageal adenocarcinoma cell lines were transduced by the lentiviral particles followed by puromycin selection (1 μg/mL) for 10 days. The cells stably expressing shRNA were maintained in puromycin (0.2 μg/mL).

To knockdown ZFP36 expression in human glioma neural stem cells, we used the commercially available pGIPZ-lentiviral shRNAmir vectors containing a hairpin sequence targeting ZFP36 (Open Biosystems). The hairpin sequence was as follows: CGACTTTATTTATTCTAATATTACATCTGTGGCTTCACTAATATTAGAATAAATAAAGTCG.
The shRNA-containing lentiviral vector (Open Biosystems) was cotransfected with lentiviral packaging constructs into HEK293T cells to produce shRNA-carrying lentivirus particles. Supernatants were collected at 48 h after transfection and viral particles were concentrated using PEG (System Biosciences). GNS cells were transduced (MOI = 10) for 1 h and subsequently supplemented with fresh media. After expansion, cells were sorted (MoFlo cell sorter, Beckman Coulter Inc.) based on GFP expression values, obtaining two homogeneous populations expressing either the (pGIPZ) scrambled vector, or pGIPZ shRNA ZFP36 (shZFP36). To perform over-expression experiments, the coding sequence of ZFP36 [4 (link)] was cloned in the pRRLSIN.cPPT.PGK-GFP.WPRE vector. The procedure for producing the lentiviral particles and infecting the cells was the same as described for the pGIPZ vectors. ZFP36 expressing cells were used for experiments 24 to 48 hours after infection.

pGIPZ-lentiviral shRNAmir vectors targeting human Nox4 gene and nonsilencing pGIPZ control vector were purchased from Open Biosystems (Thermo Fisher Scientific, Inc.). pGIPZ cloning vector contains Turbo GFP reporter and expresses a puromycin-resistant gene. Lentiviral shRNA was produced by cotransfection of the Trans-Lentiviral Packaging Mix with a shRNA transfer vector into HEK 293T packaging cells (Open Biosystems). Supernatants containing either the lentivirus expressing the Nox4 shRNA or the control shRNA were harvested 72 h after transfection. The lentiviruses were purified using ultracentrifugation, and the titer of the lentiviruses was determined. U87MG and U251 cells were transduced by the lentiviral particles at a multiplicity of infection (MOI) of 10 followed by puromycin selection for 10 days. The clones stably transfected with pGIPZ-lentiviral shRNAmir was referred to as Nox4 shRNA cells, whereas the cells stably transfected with pGIPZ nonsilencing control vector as scrambled cells. The knockdown of Nox4 was evaluated by real-time quantitative PCR and Western blot analysis.