Mode of action via LpxC was confirmed by an increase in MIC upon over-expression of P. aeruginosa LpxC. To that end, derivatives of P.aeruginosa PAO1 and its efflux mutant were created that either contained an LpxC expression plasmid, pLH1783 or an empty control plasmid pUCP1852 (link),53 (link). Plasmid pLH1783 was constructed by amplification of lpxC from P. aeruginosa PAO1 genomic DNA using oligonucleotides ACGTGAATTCATGATCAAACAACGCACCTTG and ACGTAAGCTTCTACACTGCCGCCGCCGGGCGC. The PCR product was purified and digested with EcoRI and HindIII, ligated into similarly digested pUCP1852 (link), and transformed into E. coli DH5α-T1R chemically competent cells (Life Technologies). Transformants were selected on LB agar plates with 25 μg/mL ampicillin, and the plasmid was verified by sequencing. Plasmids were transformed into P. aeruginosa strains53 (link) and selected on LB agar plates containing 250 μg/ml carbenicillin. Strains were pregrown on MHBII agar plates containing 250 μg/mL carbenicillin to ensure the presence of the plasmids; when determining MIC values, however, carbenicillin was absent from the medium.
E coli dh5α t1r
Manufactured by Thermo Fisher Scientific
E. coli DH5α-T1R is a laboratory strain of Escherichia coli bacteria. It is a commonly used host strain for cloning and genetic engineering applications.
Automatically generated - may contain errors
Lab products found in correlation
Glucose, by Carl Roth (1 mentions)
Albumin dextrose saline, by Merck Group (1 mentions)
Kanamycin, by Merck Group (1 mentions)
Glycerol, by Carl Roth (1 mentions)
7h10 agar, by Merck Group (1 mentions)
Hygromycin b, by Carl Roth (1 mentions)
Tween 80, by Carl Roth (1 mentions)
Lb agar plates, by Carl Roth (1 mentions)
Middlebrook 7h9 medium, by BD (1 mentions)
2 protocols using e coli dh5α t1r
1
Validating LpxC as Antimicrobial Target
2
Cloning and Propagation of Bacterial Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All cloning and plasmid propagation were conducted in E. coli DH5α‐T1R (Life Technologies) using standard protocols. E. coli was transformed by conventional heat shock transformation and grown in Lennox Broth (LB) or LB agar plates (Carl Roth). The seamless ligation cloning extract (SLiCE) was produced from the E. coli DH10B‐PPY strain.27 In liquid cultures M. smegmatis mc2155 groEL1ΔC16 was grown in Middlebrook 7H9 medium (BD Biosciences) supplemented with 0.2% (w/v) glucose (Carl Roth), 342 mM NaCl), 0.05% (v/v) Tween‐80 (Carl Roth) and 0.2% (v/v) glycerol (Carl Roth). Alternatively, the solid growth media used was 7H10 agar (Sigma‐Aldrich) supplemented with 10% albumin–dextrose saline (ADS: 5% (w/v) BSA cold ethanol fraction, pH 5.2, ≥96% (Sigma‐Aldrich), 2% (w/v) glucose (Carl Roth), 342 mM NaCl), 0.05% (v/v) Tween‐80 (Carl Roth) and 0.2% (v/v) glycerol (Carl Roth). All bacterial strains were grown at 37° C. Where required the growth media was supplemented with 94 μM hygromycin B (Carl Roth) or 35 μM kanamycin (Sigma‐Aldrich).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!