Uacc 812

MCF-7, BT474, BT483, CAMA1, Uacc812, ZR75-1 ZR75-30 and T47D breast cancer cell lines were purchased from American Type Culture Collection [ATCC], Manassas, VA, USA. SUM44PE was purchased from Asterand Bioscience, Detroit, MI, USA, and 600MPE cells were a gift by Dr. Rachel Schiff. For the estrogen removal experiments, the cells were kept for 5 days in IMEM supplemented with 10% charcoal stripped serum (CSS) with 1nM E2, and then plated into 96-well plates with or without 1 nM estradiol. An exception are Sum44PE cells that were kept in IMEM with 2% CSS. After 5 days, cell numbers were measured using Cell-titer Glo (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Luminescence was measured with GloMax^®multi-Detection System (Promega, Madison, WI, USA), using a VICTOR X4 plate reader (PerkinElmer, Waltham, MA, USA). Bars represent the mean of six biological replicates ± SD. 17β-Estradiol (E2) was obtained from Sigma-Aldrich (St. Louis, MO, USA).

The BC cell lines (HCC70 and UACC-812) and human mammary cells (76 N-F2V) used in this study were gained from American Type Culture Collection (ATCC, Manassas, VA, USA). These cells were incubated in RPMI-1640 medium with 10% fetal bovine serum (FBS) and a supplement of 100 μg/L streptomycin and 100 μg/L penicillin under the conditions of 37 °C and 5% CO₂.

The breast cancer cell lines MCF-7, MDA-MB-231, MDA-MB-468, T-47D, UACC-812, and MCF-10A were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). MCF-7, T-47D, MDA-MB-468 cells were maintained in Dulbecco's Modified Eagle Medium (DMEM; GIBCO, NY, USA) supplemented with 10% fetal bovine serum (FBS; HyClone). MCF-10A cells were cultured in MEBM BulletKit (Lonza, Basel, Switzerland). The two cell lines were cultured in a humidified incubator equilibrated at 37 °C in 5% CO₂. MDA-MB-231 and UACC-812 cells were cultured in L-15 (GIBCO) with 10% FBS without CO₂, supplemented with antibiotics (100 U/ml penicillin and 100 mg/ml streptomycin; Sigma-Aldrich, USA). The cell lines in the experiments were validated by STR DNA analysis and were negative for mycoplasma.

The HER2+ breast cancer cell lines UACC812 and SKBR3 were originally purchased from the American Type Culture Collection (Manassas, VA, USA) and authenticated by short tandem repeat analysis. UACC812 and SKBR3 cells were cultured in DMEM and RPMI-1640, respectively, supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. All cells were cultured in a humidified incubator containing 5% CO₂ at 37°C. For experiments, cells were treated with trastuzumab (20 μM), pertuzumab (20 μM), phlorizin (100 μM), MG132 (10 μM), or vehicle. The promoter-driven siRNA vector with GFP expression was constructed by GenScript Corp. The target sequence for SGLT1 siRNA was TCTTCCGCATCCAGGTCAAT, and the control siRNA sequence was GAACAATGTTGACCAGGTGA.