Total RNA was extracted from cells using Qiagen RNeasy Mini Kit (Valencia, CA, USA). cDNA was made from 500 ng of total RNA using Random Primers (Invitrogen, Carlsbad CA) and Superscript II RT-PCR reagents (Invitrogen, Carlsbad CA) and analyzed using the ABI 7900HT Fast Real-Time PCR System with the following proprietary FAM labeled primers: Ror2, MMP2, 18S, and β-actin (Applied Biosystems, Foster City CA).
Superscript 2 rt pcr
Manufactured by Thermo Fisher Scientific
SuperScript II RT-PCR is a reverse transcriptase enzyme used for cDNA synthesis and real-time PCR applications. It is a high-performance, RNase H-deficient reverse transcriptase that provides efficient and sensitive cDNA synthesis from various RNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sybr green quantifast rt qpcr master mix, by Qiagen (2 mentions)
Quantistudio 6 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Random primer, by Thermo Fisher Scientific (1 mentions)
Mmp 2, by Thermo Fisher Scientific (1 mentions)
β actin, by Thermo Fisher Scientific (1 mentions)
Abi 7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Hot firepol evagreen qpcr mix plus, by Solis BioDyne (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Stratagene mx3000, by Agilent Technologies (1 mentions)
Quantifast sybr green pcr kit, by Qiagen (1 mentions)
Applied biosystems quantstudio 6 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Mx3000p qpcr system, by Agilent Technologies (1 mentions)
Sybr master mix kit, by Takara Bio (1 mentions)
Specific primers, by Genechem (1 mentions)
Trizol reagent, by Sangon (1 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
7 protocols using superscript 2 rt pcr
1
Real-Time PCR Analysis of Gene Expression
2
Quantification of Transcript Levels by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For analysis of transcription levels by qPCR, cells were grown as described above, and samples of 2x107 cells were collected at the indicated time points. RNA was purified by use of RNeasy (Invitrogen, Carlsbad, CA), and cDNA was made by SuperScript II RT-PCR (Invitrogen, Carlsbad, CA) using oligo dT primers (Figs 1C and 2B ) or by QuantiTect Reverse Transcription Kit (Qiagen) using random primers (Fig 1D ). mRNA levels were quantified by Real-time PCR performed with HOT FIREPol EvaGreen qPCR Mix Plus (Solis Biodyne, Tartu, Estonia) using a Stratagene MX3000 (Agilent, Santa Clara, CA) and normalized to the ACT1 and GAPDH mRNA levels. Primer sequences are listed in Table 2 .
3
Quantitative RT-PCR Profiling of Embryonic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from 3-5 embryos at specific developmental ages was prepared using the TRIzol reagent (Invitrogen) extraction method.21 First strand cDNA was made using the Superscript II RT-PCR (Invitrogen, 11904-018) protocol. Each RT-qPCR had a 10 µl final volume containing 0.5 µl of cDNA, 500 nM of each primer and 5 µl of Quantifast SYBR Green PCR Kit (Qiagen). RT-qPCR primers are listed in the Table . An Applied Biosystems QuantStudio 6 Real-Time PCR system (Thermo Fisher Scientific) was used for all experimental procedures. Gene expression was normalized relative to reference gene β-actin. Reactions were performed in three technical replicates, and all results made from three independent biological replicates. Fluorescence was measured after each cycle and a melt curve analysis conducted to verify the purity of samples. Equipment software automatically calculated baseline, threshold Cq, and fold changes.
4
Cardiac Gene Expression Analysis in Zebrafish Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from embryos was prepared using the TRIzol reagent (Invitrogen) extraction method [34 (link)]. Embryonic hearts at specific developmental ages were collected in Trizol and homogenized using a 26½ gauge syringe. First strand cDNA was made using the Superscript II RT-PCR (Invitrogen, 11,904–018) protocol with 100 ng of total RNA for conversion. Each RT-qPCR reaction had a 10 μl final volume containing 0.5 μl of cDNA, 500 nM of each primer and 5 μl of SYBR Green QuantiFast RT-qPCR master mix (Qiagen). Primers used were: bmp4a (F: 5’ – GACCCGTTTTACCGTCTTCA; R: 5’- TTTGTCGAGAGGTGATGCAG); irx1a (F: 5’- CAAGATGACCCTCACGCAAG; R: 5’- CCAGGTCACCTTGTTCTCCT); tbx5a (F: 5’- AACCATCTGGATCCCTTCG; R: 5’- TGTTTTCATCCGCCTTGAC). An Applied Biosystems QuantiStudio 6 Real-Time PCR system was used, and gene expression was normalized relative to ß-actin (F: 5’-GCAGAAGGAGATCACATCCCTGGC; R: 5’- CATTGCCGTCACCTTCACCGTTC). Reactions were performed in three technical replicates, and all results made from 3–4 independent biological replicates.
5
Embryonic RNA Extraction and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from embryos was prepared using the TRIzol reagent (Invitrogen) extraction method 29 (link) . Briefly, 5 embryos or embryonic hearts at specific developmental ages were collected in Trizol and homogenized using a 26½ gauge syringe. First strand cDNA was made using the Superscript II RT-PCR (Invitrogen, 11904-018) protocol with 100 ng of total RNA for conversion. Each RT-qPCR reaction had a 10 µl final volume containing 0.5 µl of cDNA, 500 nM of each primer and 5 µl of SYBR Green QuantiFast RT-qPCR master mix (Qiagen). Primers used were: sema3fb (F: 5'-AGTGACGCATATGGCTCTGC; R: -5'-AGGAAGCCTCTTCTGCGAGG); bmp4a (F: 5' -GACCCGTTTTACCGTCTTCA; R: 5'-TTTGTCGAGAGGTGATGCAG) (Morris et al., 2011); tbx5a (F: 5'-AACCATCTGGATCCCTTCG; R: 5'-TGTTTTCATCCGCCTTGAC). An Applied Biosystems QuantiStudio 6 Real-Time PCR system was used, and gene expression was normalized relative to reference gene ß-actin (F: 5'-GCAGAAGGAGATCACATCCCTGGC; R: 5'-CATTGCCGTCACCTTCACCGTTC). Reactions were performed in three technical replicates, and all results made from 3-4 independent biological replicates.
6
RNA Extraction and Quantitative RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was separated from dissected tumor and non-tumor tissues, and three cell lines, using the TRIzol® reagent (Sangon Biotech Co., Ltd.), based on the manufacturer's protocols. RT was executed using 2 µg total RNA, 1 µl (200 units) RT-PCR SuperScript II (Invitrogen; Thermo Fisher Scientific, Inc.) and 50 µM decamer at 37°C for 50 min. Specific primers targeting OIP5 were designed by Shanghai GeneChem Co., Ltd. as follows: 5′-TGGCATTGAAGGTTCACTCA-3′ (forward) and 5′-AGGGCAGCATGGGTAGAATA-3′ (reverse), with a product length of 189 bp. RT-qPCR was performed by SYBR® Master Mix Kit (Takara Biotechnology Co., Ltd., Dalian, China) on a Mx3000P qPCR system (Agilent Technologies, Inc., Santa Clara, CA, USA) and LightCycler 480 (Roche Diagnostics, Indianapolis, IN, USA). The housekeeping gene GAPDH was used for normalization. Data were calculated using the Pfaffl method (22 (link)). PCR primers used for validating the microarray data are listed in Table II . The thermal profile conditions were 30 sec at 95°C, 30 sec at 62°C and 30 sec at 72°C for 40 cycles, and a final extension at 72°C for 5 min.
7
Quantitative Real-Time RT-PCR for OIP5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA prepared from dissected tissues was precipitated with isopropanol and dissolved in DEPC-treated distilled water. Reverse transcription (RT) was performed using 2 μg total RNA, 50 μM decamer, and 1 μl (200 units) RT-PCR Superscript II (Invitrogen) at 37°C for 50 min. Specific primers for OIP5 were designed employing the Primerdepot website (http://primerdepot.nci.nih.gov/ ): OIP5 (accession No. NM_007280), 5'- TGGCATTGAAGGTTCACTCA −3' (forward), and 5'- AGGGCAGCATGGGTAGAATA −3' (reverse). A control 18S ribosomal RNA primer from Applied Biosystems was used as the invariant control. The real-time RT-PCR reaction mixture, which consisted of 10 ng reverse-transcribed total RNA, 167 nM forward and reverse primers, and 2 × PCR master mixture in a final volume of 10 μl, was placed in 384-well plates and analyzed using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!