For viral RNA extraction in the infected cells, cells were retrieved from Matrigel using 500 ul of Cell Recovery Solution (Corning), and were lysed by repetitive freezing at −80°C and thawing 3 times. Then, QIAamp Viral RNA Mini Kit (Quiagen) was used to obtain SARS-CoV-2 viral RNA according to the manufacturer’s instructions. For collection of viral RNAs from culture media, 140 ul of the culture media was obtained followed by QIAamp Viral RNA Mini Kit (QIAGEN).
Qiaamp viral rna mini kit
Manufactured by Qiagen
Sourced in Germany, United States, United Kingdom, France, Spain, Japan, China, Netherlands, Italy, Australia, Canada, Switzerland, Belgium
The QIAamp Viral RNA Mini Kit is a laboratory equipment designed for the extraction and purification of viral RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and isolate viral RNA, which can then be used for downstream applications such as RT-PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (117 mentions)
Onestep rt pcr kit, by Qiagen (67 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (64 mentions)
Qiaquick pcr purification kit, by Qiagen (52 mentions)
Taqman fast virus 1 step master mix, by Thermo Fisher Scientific (48 mentions)
Qiaquick gel extraction kit, by Qiagen (46 mentions)
Quantitect probe rt pcr kit, by Qiagen (45 mentions)
Trizol reagent, by Thermo Fisher Scientific (38 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (38 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (37 mentions)
Trizol ls, by Thermo Fisher Scientific (35 mentions)
Tissuelyser 2, by Qiagen (34 mentions)
Superscript 3, by Thermo Fisher Scientific (34 mentions)
One step primescript rt pcr kit, by Takara Bio (32 mentions)
Qiaamp dna mini kit, by Qiagen (30 mentions)
Miseq platform, by Illumina (28 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (26 mentions)
Abi 3130 genetic analyzer, by Thermo Fisher Scientific (25 mentions)
Qiacube, by Qiagen (25 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (25 mentions)
3 312 protocols using qiaamp viral rna mini kit
1
SARS-CoV-2 Viral RNA Extraction
2
Molecular Screening for Influenza D Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In France, RNA extraction was performed on 140 µl of the clinical sample with the QIAamp viral RNA minikit (Qiagen), following the manufacturer protocol, and stored at −80°C. IDV screening in clinical samples was performed by Quantitative reverse transcription PCR (RT-qPCR) using primers (0.8 µM of final concentration) and hydrolysis probe (0.2 µM of final concentration) as described in Hause et al. (2013) (link) using the QuantiNova probe RT-PCR kit (Qiagen, Germany). The RT-qPCR reactions were carried out on a LightCycler ninety-six real-time PCR system (Roche, Switzerland) with the following cycling conditions: 45°C for 30 min, 95°C for 15 min, followed by forty cycles at 95°C for 5 s, and 60°C for 30 s. In Italy, IDV molecular screening was carried out as described in Faccini et al. (2017) (link). In Luxembourg, RNA extraction was performed with the QIAamp viral RNA minikit (Qiagen). The presence of IDV in clinical samples was tested by real-time RT-PCRs by using the primers (0.4 µM of final concentration) and probe (0.15 µM of final concentration) as described in Hause et al. (2013) (link) using the QuantiTect probe RT-PCR kit (Qiagen). Cycling conditions were as follows: 50°C for 30 min, 95°C for 15 min, followed by forty-five cycles at 95°C for 15 s, and 60°C for 40 s.
3
Stool Sample RNA Extraction for RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from these stool samples using the QIAamp Viral RNA Mini Kit (Qiagen; Catalog # 52906) as previously optimized (32 (link)). Briefly, the prepared stool samples were spun down at 10,000x g for 2 minutes to acquire 140 µL of clarified supernatant. RNA was extracted from this supernatant using the QIAamp Viral RNA Mini Kit (Qiagen; Catalog # 52906) as per the manufacturer’s instructions. Finally RNA was eluted in 100 µL of the elution buffer and stored in a 96-well plate at −80°C for up to 12 months. In previous work on BCoV and SARS-CoV-2 RNA (32 (link)) we found that RNA extracted using this method did not result in RT-PCR inhibitors. Therefore, we assume that samples extracted here also do not have any RT-PCR inhibitors.
4
Evaluating Cross-Reactivity of SARS-CoV-2 with Coronaviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To cross-reaction with other close-phylogenic viruses of the family Coronaviridae, human coronavirus 229E, human coronavirus OC43, human corona-virus HKU1, human coronavirus NL63, SARS coronavirus, and MERS coronavirus culture were involved. All of inactive cultures were supplied by national Institutes of Food and Drug Control. Moreover, the following 7 viruses were also be tested: H1N1
(in uenza virus A/PR/8/34); H3N2 (in uenza virus A/Beijing/30/95); in uenza virus B (Hongkong/5/72); parain uenza viruses 1, 2, and 3; and respiratory syncytial virus. Total RNA was extracted from 140 µl viral culture supernatant using a QIAamp Viral RNA Mini Kit (Qiagen GmbH, Hilden, Germany). RNA was eluted from the columns with 50 µl diethyl pyrocarbonate (DEPC)-treated water. All RNA were diluted to approximately 10 6 copies/ml, and concentrations of them were determined using digtal PCR [13] .
Twenty-seven BALF samples from patients with different viral pneumonia before June, 2019 were also tested, which included 8 diagnosed as human coronavirus 229E, 2 diagnosed as human coronavirus OC43, 2 diagnosed as human coronavirus HKU1, 15 diagnosed as human adenovirus 7. Throat swabs from 30 patients with con rmed H1N1 infection and 77 healthy peoples in Beijing were also involved. Total RNA was extracted from 140 µl samples using a QIAamp Viral RNA Mini Kit (Qiagen GmbH, Hilden, Germany).
(in uenza virus A/PR/8/34); H3N2 (in uenza virus A/Beijing/30/95); in uenza virus B (Hongkong/5/72); parain uenza viruses 1, 2, and 3; and respiratory syncytial virus. Total RNA was extracted from 140 µl viral culture supernatant using a QIAamp Viral RNA Mini Kit (Qiagen GmbH, Hilden, Germany). RNA was eluted from the columns with 50 µl diethyl pyrocarbonate (DEPC)-treated water. All RNA were diluted to approximately 10 6 copies/ml, and concentrations of them were determined using digtal PCR [13] .
Twenty-seven BALF samples from patients with different viral pneumonia before June, 2019 were also tested, which included 8 diagnosed as human coronavirus 229E, 2 diagnosed as human coronavirus OC43, 2 diagnosed as human coronavirus HKU1, 15 diagnosed as human adenovirus 7. Throat swabs from 30 patients with con rmed H1N1 infection and 77 healthy peoples in Beijing were also involved. Total RNA was extracted from 140 µl samples using a QIAamp Viral RNA Mini Kit (Qiagen GmbH, Hilden, Germany).
5
Fecal AstV RNA Extraction and NGS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RNA extractions from fecal suspensions for AstV-screening by RT-PCR were done with the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) and RNA isolation from brain tissue was performed with TRI Reagent (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturers’ protocols. To prepare samples for NGS, 500 μL of fecal suspensions were centrifuged at 16,000×g for 3 min. The supernatants were then centrifuged through Vivaclear MINI Clarifying filters with 0.8 μm PES (Sartorius, Göttingen, Germany) at 2,000×g for 5 min. Next, 280 μL of the filtrates were treated with 2 μL Benzonase (1U/μL) (Merck, Kenilworth, NJ, USA) for 2 h at 37 °C. The Benzonase was inactivated by adding ethylenediaminetetraacetic acid (EDTA) to a final concentration of 5 mM. Finally, RNA extraction was performed with the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) with the modification that the carrier RNA was omitted. RNA extracts were stored at –80 °C until further analysis.
6
RNA Extraction in BSL-3 Lab using PAPR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The staff extracted RNA in the BSL-3 Lab wearing two layers of PPE. The inner PPE included a protective suit, an N95 mask, a pair of inner gloves and a pair of dedicated shoes and waterproof shoe covers (S1 Fig ). The external PPE included a HEPA filter-equipped powered air purifying respirator (3M, USA), a disposable sterilized surgical gown, a pair of external gloves and waterproof shoe covers (S1 Fig ). The specimen bucket was opened within the biosafety cabinet. As Buffer AVL in the QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD, USA) was insufficient to inactivate samples [14 (link)], a combination of physical and chemical inactivation was performed to enhance the inactivation efficiency. The specimens were first inactivated by incubation in a water bath at 62°C for 1h before opening the tube cap to pipette the samples and were then further inactivated by the addition of Buffer AVL to the samples.
RNA was extracted using the QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s protocol. All waste was first chemically inactivated (with 0.25% chlorine-containing disinfectant), then sterilized using a double-leaf autoclave and finally incinerated.
RNA was extracted using the QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s protocol. All waste was first chemically inactivated (with 0.25% chlorine-containing disinfectant), then sterilized using a double-leaf autoclave and finally incinerated.
7
Viral RNA Extraction from Various Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
140 μl of each sample of virus isolates and sera were extracted using QIAamp Viral RNA Minikit (QIAGEN AG, Hombrechtikon, Switzerland), following manufacturer instructions (elution in 60μl).
RDT sections and FP discs were processed according to the procedure described for dried swabs in the EZ1 Virus Mini Kit v2.0 handbook (Qiagen). They were incubated for 15 minutes at 56°C with 200μl of ATL lysis buffer (Qiagen) and then 140 μl of the mixture was extracted using the QIAamp Viral RNA Minikit (Qiagen), following manufacturer’s instructions, with 60μl elution volume.
RDT sections and FP discs were processed according to the procedure described for dried swabs in the EZ1 Virus Mini Kit v2.0 handbook (Qiagen). They were incubated for 15 minutes at 56°C with 200μl of ATL lysis buffer (Qiagen) and then 140 μl of the mixture was extracted using the QIAamp Viral RNA Minikit (Qiagen), following manufacturer’s instructions, with 60μl elution volume.
8
Quantification of HIV-1 RNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasma viremia was assayed using one-step reverse transcriptase real-time PCR (TaqMan assay) with an automated CFX96 Touch real-time PCR detection system (Bio-Rad). We modified the qRT-PCR setup from Sathessan et al. and use their HIV long terminal repeat (LTR) primer set (22 (link)). The HIV-1 level in peripheral blood was determined by extracting RNA from blood plasma using the QIAamp viral RNA minikit (Qiagen) and performing TaqMan qPCR using either a primer and probe set targeting the HIV-1 LTR region (FPrimer, GCCTCAATAAAGCTTGCCTTGA ; RPrimer, GGCGCCACTGCTAGAGATTTT ; probe, 5′FAM/AAGTAGTGTGTGCCCGTCTGTTGTGTGACT /3IABkFQ) or the HIV-1 Pol region (FPrimer, GACTGTAGTCCAGGAATATG ; RPrimer, TGTTTCCTGCCCTGTCTC ; probe, 5′Cy5/CTTGGTAGCAGTTCATGTAGCCAG /3′IABkFQ], using the TaqMan fast virus 1-step master mix (Applied Biosystems). According to the manufacturer’s instruction (QIAamp viral RNA minikit [Qiagen]), the protocol is designed for purification of viral RNA from minimal 140 μL plasma. In our study, the plasma sample was expanded by dilution (generally 1 to 3 dilutions) because a limited volume of plasma (20 to 60 μL) was available. We calculated our limit of detection (LOD) for both HIV LTR and HIV Pol primer to be ∼500 RNA copies/mL based on our qRT-PCR setup and dilution of samples. Therefore, we defined values below that LOD number as undetectable.
9
RNA Extraction from Biological Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the various samples was extracted using the Qiagen RNeasy Mini kit (for brain and cell culture medium) or the Qiagen QIAamp viral RNA Mini kit (for serum and CSF) (Qiagen, Hilden, Germany). Brain samples (400 mg) were first homogenised in 1 mL of PBS with a Potter homogenator. Eighty-five microliter of the brain homogenate was mixed with 265 µL of lysis buffer (RLT) and used for RNA extraction. From here on, the instructions from the RNeasy Mini kit were followed. For RNA extractions from infected cell culture supernatants, a volume of 150 µL was homogenised in 200 µL of RLT buffer, as starting material for the RNA extraction. Starting from serum or CSF, a volume of 140 µL was used for RNA extraction with the Qiagen QIAamp viral RNA Mini kit following the manufacturer's instructions.
10
Viral RNA Extraction from Clinical and Wastewater Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For clinical samples collected in Australia, 20% (v/v) suspensions in water were prepared. Viral RNA extraction was performed using QIAamp Viral RNA mini kit (Qiagen, Hilden, Germany) following manufacturer’s instructions12 (link). For clinical samples collected in NZ, 20% (v/v) suspensions were prepared and clarified with chloroform as previously described29 (link). Viral RNA extraction was performed using the Roche Viral Nucleic Acid Extraction Kit (Roche, Basel, Switzerland) in accordance to the manufacturer’s instructions.
Waste water samples (12 mL) were centrifuged at 9400 × g at room temperature for 15 min to remove debris. The supernatant was ultra-centrifuged at 186,000 × g at 4 °C for 1.5 h to concentrate virus and the pellet resuspended in 100 µL of phosphate-buffered saline. Viral RNA extraction was performed using QIAamp Viral RNA mini kit (Qiagen)12 (link).
Waste water samples (12 mL) were centrifuged at 9400 × g at room temperature for 15 min to remove debris. The supernatant was ultra-centrifuged at 186,000 × g at 4 °C for 1.5 h to concentrate virus and the pellet resuspended in 100 µL of phosphate-buffered saline. Viral RNA extraction was performed using QIAamp Viral RNA mini kit (Qiagen)12 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!