The largest database of trusted experimental protocols

25 protocols using n ter nanoparticle sirna transfection system

1

Transient Transfection of siRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transient transfections of siCtrl, siRAD51, siXRCC4 and siTEAD4 were achieved using N-TER™ Nanoparticle siRNA Transfection System (Sigma, N2913) while siBRCA1 (from Dharmacon; L-003461-00-0005) was transfected with lipofectamin (from ThermoFisher) according to the manufacturers.
+ Open protocol
+ Expand
2

Transfection of Axons with miRNA Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
N-TER Nanoparticle siRNA Transfection System (Sigma-Aldrich, St. Louis, MO.) was employed to transfect axons with inhibitors and mimics. Briefly, on DIV3 when all of the microgrooves were fully filled with axons, miRNA hairpin inhibitors or LNA inhibitors against rat miR-29c (final concentration 20nM, mature sequence: UAGCACCAUUUGAAAUCGGUUA of hairpin inhibitor and ACCGATTTCAAATGGTGCT of LNA inhibitor) or miR-29c mimics along with nanoparticle packed in N-TER peptide in growth medium was applied to the axonal compartment for 72h. Caenorhabditis elegans miR-67 (cel-miR-67, mature sequence: UCACAACCUCCUAGAAAGAGUAGA), which lacks homolog in mammals, was used as a negative control (Dharmacon, Lafayette, CO, USA).
+ Open protocol
+ Expand
3

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were settled in multi-well plates for 24 h and then subjected to the indicated experimental conditions. NucleoSpin RNAII Kit (Macherey-Nagel, Düren, Germany) was then utilized to extract total RNA. Complementary DNA was synthesized from RNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Penzberg, Germany).
qRT-PCR was performed using Power Sybr Green Mastermix (Ambion Austin, TX, USA) and KiCqStart® SYBR® Green Primers (Sigma-Aldrich, Table 1) in a CFX384 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Gene expression was measured by the ∆∆Ct method.
For AQP3, RNAi was performed by transfecting cells with 5 µM siRNA oligonucleotides (Sigma-Aldrich, Table 2) or with equimolar scramble siRNA by using the N-ter Nanoparticle siRNA Transfection System (Sigma-Aldrich).
For TRPM2, RNAi was performed using esiRNA (esiRNA Human TRPM2, cat. no. EHU133821, Sigma-Aldrich).
Scramble siRNA was obtained using commercial non-targeting siRNA (MISSION siRNA Universal Negative Control).
Cells were collected at 24 h after transfection and used for the experiments.
+ Open protocol
+ Expand
4

Manipulating miR-155 in Primary Monocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary human monocytes were transfected using the N-TER Nanoparticle siRNA Transfection System (Sigma-Aldrich) according to the manufacturer's instructions. After initial treatment of control (DMSO) or 100 nM IκK-16 for 1 h, monocytes were transfected with miR-155 mimics or antagomirs (Life Technologies, Foster City, CA, USA) at a concentration of 40 nM/well for 16 h. Control cells were transfected with scramble miRs as a negative control (sham). After 16 h of transfection, the medium was replaced with fresh medium and the cells were stimulated with 100 ng/mL LPS for an additional 6 and 24 h. Cells were collected for RNA isolation, whereas supernatants were collected for cytokine measurements. Effective transfection was confirmed by determining miR-155 levels in isolated RNA by qRT-PCR, using RNU6B as described, ensuring upregulation of miR-155 cells transfected with mimics and downregulation of miR-155 in cells transfected with antagomirs, relative to sham conditions.
+ Open protocol
+ Expand
5

Regulation of hOCTN1 expression in RASF

Check if the same lab product or an alternative is used in the 5 most similar protocols
To down-regulate hOCTN1 expression, RASF were transfected with either 40 nM hOCTN1 siRNA (Sigma-Aldrich; GACAAUUUACUGUGAGUUA) or non targeting scramble siRNA (Invitrogen; nonsilencing control siRNA) using a N-TER™ Nanoparticle siRNA Transfection System® (Sigma) according to the manufacturer’s instructions. The transfection efficiency was verified by PCR. The dependence of saracatinib biological impact on hOCTN1 expression in RASF was assessed at the molecular level by determination of c-Abl activity. RASF transfected with hOCTN1- or scramble-siRNA were incubated with 1 μM or 10 μM saracatinib and 10 ng/ml PDGF for 10 min, and total extracts were examined for c-Abl activation by Western blotting using anti-phospho Abl (Cell signaling, Danvers, USA; diluted 1:500) and GAPDH antibody (Sigma-Aldrich). The part of membrane containing GAPDH, as determined from molecular weight markers, was cut and the expression of GAPDH was detected as loading control. Western blots were quantified by ImageJ software (NIH, Bethesda, MD, USA).
+ Open protocol
+ Expand
6

Silencing Human SLC39A8 with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 21-mer short interfering RNA (siRNA) with target sequence directed against human SLC39A8 and scramble siRNA were purchased from Sigma-Aldrich (St. Louis, MO, USA) with the following catalogue numbers: control siRNA: MISSION siRNA Universal Negative Control #1 SIC001; human SLC39A8 siRNA, SASI_Hs02_00355573. The siRNA transfection was performed using the N-TER™ Nanoparticle siRNA Transfection System (Sigma-Aldrich).
+ Open protocol
+ Expand
7

Silencing NHE1 in Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
NHE1 siRNA (NM_003047; SASI_Hs01_00025997) and universal negative control siRNA (SIC001) were obtained from Sigma-Aldrich. For siRNA transfection, EA.hy926 cells were grown to 50–60% confluency in gelatine-coated culture dishes and transfected with NHE1 siRNA (50 nM) or scrambled siRNA (50 nM), using the N-TER nanoparticle siRNA transfection system (Sigma-Aldrich), according to the instructions of the manufacturer. For western blotting and qPCR cells were lysed 48 h post transfection.
+ Open protocol
+ Expand
8

siRNA-Mediated Knockdown of VASP, Cofilin, Gα13, and RhoA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNA (siRNA) duplexes targeting VASP (5′-GGACCUACAGAGGGUGAAAdTdT-3′) were designed and synthesized by RiboBio (Guangzhou, China). The siRNA duplexes (#6267) targeting cofilin was obtained from Cell Signaling Technology. The siRNA of Gα13 (#RI12255) and RhoA (#RI14534) were obtained from Abgent (Suzhou, China). Transfection was performed using N-TER Nanoparticle siRNA Transfection System (Sigma-Aldrich) according to the manufacturer's protocol. In brief, 1×104 A375 cells were plated in 35-mm dishes and cultured overnight. VASP (20 nM), Cofilin (40 nM), Gα13 (40 nM), RhoA (40 nM) and negative control siRNA (20 nM) were transfected into cells, respectively. After 72 h incubation at 37°C, the silencing efficiency was determined by Western blot using specific antibodies. After knockdown for 72 h, the effect of CuB on VASP phosphorylation and actin cytoskeleton were measured by western blot and immunofluorescence microscopy.
+ Open protocol
+ Expand
9

Knockdown of CD34 in C-MSC via siRNA Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human CD34 siRNA (SMARTpool: ON-TARGETplus; L-019503-00-005, sequences 5′-UAACCUCAGUUUAUGGAAA−3′, 5′-GCACUAGCCUUGCAACAUCC−3′, 5′-GCGCUUUGCUUGCUGAGUU−3′, and 5′-CCACUAAACCCUAUACAUC−3′) and non-targeting siRNA (ON-TARGETplus #1) were obtained from Dharmacon, GE Lifesciences, Buckinghamshire, UK. For transfection, C-MSC were seeded at 3.2 × 103 cells/cm2 and transfection was performed using the N-TER nanoparticle siRNA transfection system (Sigma-Aldrich), according to manufacturer’s instructions. For effective knockdown of CD34, transfection was performed twice on the same cells, with the second transfection occurring 48 h after the first. Viability measurements were taken 48 h after each transfection. RNA was collected for RT-qPCR analysis, 48 h after the second transfection.
+ Open protocol
+ Expand
10

Silencing EZH2 Expression with siRNA and TSA Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols
The siRNAs targeting EZH2 (SASI_Hs01_00147882) and negative control (MISSION siRNA Universal Negative Control) were obtained from Sigma-Aldrich. Cells were transfected with 100 nmol/L final concentration of siRNA using N-TER Nanoparticle siRNA Transfection System (Sigma-Aldrich). After 9 h of incubation, the transfection medium was replaced with fresh medium containing TSA (0.1 μmol/L for NCI-H2170 and 0.5 μmol/L for ABC-1) or DMSO and the cells were incubated for an additional 24 h. After 24-h drug exposure, the cells were grown in drug-free medium for an additional 24 h, and the total RNA was isolated using RNAiso (Takara). The effect of siRNA was confirmed using SYBR green RT-PCR with THUNDERBIRD SYBR qPCR Mix (Toyobo). PCR conditions and the primer sequences are listed in Table S1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!