7500 real time pcr thermal cycler

Viral RNA was quantified using the iTaqTM Universal Probe One-Step RT-qPCR kit (BioRad, Hercules, CA, USA). The primers (Applied Biosystems), probes, and standard plasmid RNA (IDT, Coralville, IA, USA) are listed in ISO protocol 15216:1 (2017) [6 ]. An Applied Biosystems 7500 Real-Time PCR Thermal Cycler was used to produce the following temperature profile: 10 min at 50 °C, 3 min at 95 °C, 45 cycles of 15 s at 95 °C, and 30 s at 60 °C. Standard curves were generated using 10-fold serial dilutions of standard plasmid RNA produced for both viruses. The R² value of each standard curve was higher than 0.98 and the slopes were between −3.10 and −3.60. ROX was used as the reference dye. An automatic threshold was used to determine cycle quantification (Cq) and ∆Cq values. The number N of viral genome copies in the sample was calculated as follows:
where R is ∆Cq/M and M is the slope of the standard curve.

Total RNA was extracted from Y. lipolytica according to the manufacturer’s instructions using the Bead-Beat Total RNA Mini kit (A&A Biotechnology, Gdynia, Poland). The TranScriba kit (A&A Biotechnology, Gdynia, Poland) was used to synthesize the cDNA strands.
Quantitative PCR (qPCR) was performed in a 7,500 real-time PCR thermal cycler (Applied Biosystems, Waltham, MA, USA) using an SYBR®Green B PCR MasterMix (A&A Biotechnology, Gdynia, Poland). Each reaction contained 0.5 μl of cDNA template, 5 μl of SYBR®Green B PCR MasterMix, and 0.5 μl of forwarding and reversed primers, which were made up to 10 μl using ddH₂O. Reaction conditions were as follows:95°C for 3 min, 95°C for 15 s, 60°C for 30 s and 72°C for 30 s, 2–4 steps of 40 cycles, and melting curve phases: 94°C for 15 s, 60°C for 60 s, 95°C for 30 s, 60°C for 15 s. Each qPCR reaction was performed in technical replicates.

Total RNA isolation, reverse transcription (RT) reaction and real-time quantitative PCR (RTqPCR) were conducted as described by Borkowska et al. (2020 ). Briefly, Bead-Beat Total RNA Mini kit (A&A Biotechnology, Gdynia, Poland) and MixerMill MM400 (Retsch GmbH, Haan, Germany) were used for isolation of RNA. TranScriba Kit (A&A Biotechnology, Gdynia, Poland) and a Veriti Thermal Cycler (Applied Biosystems, USA) were used for the first cDNA strand synthesis. The RTqPCR was carried out using SYBR®Green PCR MasterMix kit B (A&A Biotechnology, Poland), FrameStar® 96 Well Semi-Skirted PCR Plates and a 7500 Real-time PCR Thermalcycler (Applied Biosystems, Foster City, USA). Real-time PCR primers targeting the intracellular stress-related genes and the internal calibrator were designed with Primer Expert Software (Applied Biosystems, Foster City, USA) (Supplemental Table S1). Comparative gene expression analysis of the treated samples was conducted vs the control culture (Fig. 1). Data analysis was carried out according to the delta-delta Ct (ΔΔCt) method (Livak and Schmittgen 2001 (link)).

Total RNA was isolated from cultured cortical neurons with the RNeasy Lipid Tissue Mini Kit (QIAGEN, #74804, Germantown, MD, USA) according to the manufacturer's instruction. The RNA was used to generate cDNA by Maxima First Strand cDNA Synthesis Kit for real‐time quantitative RT‐PCR (Thermo Fisher Scientific, #K1642) according to the manufacturer's instructions. To detect UCHL1 expression, the 3′‐untranslated region (NM_011670.2, bp 336–545) was amplified with a forward primer: 5′‐CGGCCCAGCATGAAAACTTC‐3′ and a reverse primer: 5′‐GGGACAGCTTCTCCGTTTCA‐3′. Equal amounts of cDNA were used for real‐time quantitative RT‐PCR analysis using the Power SYBR^® Green PCR Master Mix (Applied Biosystems, #4367659, Carisbad, CA, USA) according to the manufacturer's instructions. Fluorescent products were detected using a 7500 real‐time PCR thermal cycler (Applied Biosystems). Ywahz (forward primer: 5′‐AGAGTCGTACAAAGACAGCAC‐3′ and reverse primer: 5′‐GAATGAGGCAGACA AAGGTTG‐3′) was used as an internal control 33. Then the relative expression level was calculated using the following equation: relative gene expression = 2^{−(ΔCt sample − ΔCt control)}34.