Short interfering rna sirna

Manufactured by RiboBio

Sourced in China

Short interfering RNA (siRNA) is a type of lab equipment used in molecular biology and genetics research. siRNA is a class of double-stranded RNA molecules that can selectively silence or downregulate the expression of target genes by degrading their corresponding mRNA.

Automatically generated - may contain errors

Lab products found in correlation

Anti il 1β, by Proteintech (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Control sirna, by RiboBio (1 mentions) Nonspecific control, by RiboBio (1 mentions) Plko 1 puro, by Addgene (1 mentions)

3 protocols using short interfering rna sirna

Antibody Sourcing for Inflammatory Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

The anti-IL-1β and anti-NLRP3 antibodies used in the experiments in the present study were purchased from Proteintech Group (Chicago, IL, USA). Anti-caspase-1 and anti-CD68 antibodies were purchased from Wuhan Boster Biological Technology, Ltd. (Wuhan, China). Anti-P2X7 antibody was from Beijing Bioss Biosynthesis Biotechnology Co. Ltd. (Beijing, China). Anti-protein kinase R (PKR) (phospho T446) antibody was from Abcam (Cambridge, MA, USA). Short interfering RNA (siRNA) and negative control (NC) siRNA were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China).

PENG K., LIU L., WEI D., LV Y., WANG G., XIONG W., WANG X., ALTAF A., WANG L., HE D., WANG H, & QU P. (2015). P2X7R is involved in the progression of atherosclerosis by promoting NLRP3 inflammasome activation. International Journal of Molecular Medicine, 35(5), 1179-1188.

+ Open protocol

+ Expand

Silencing CIP4 and β-catenin in Rat NRK-52E Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

To silence the expression of CIP4 and β-catenin, short-interfering RNA (siRNA) specific for CIP4 and β-catenin of rats, and control siRNA, were purchased from Ribobio (Guangzhou, China). NRK-52E cells were transfected with siRNA by using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Cells were analyzed 72 h after transfection.

Xu C., Zhou Q., Liu L., Liu P., Pei G., Zeng R., Han M, & Xu G. (2015). Cdc42-Interacting Protein 4 Represses E-Cadherin Expression by Promoting β-Catenin Translocation to the Nucleus in Murine Renal Tubular Epithelial Cells. International Journal of Molecular Sciences, 16(8), 19170-19183.

+ Open protocol

+ Expand

PRPF19 Knockdown Using Lentiviral shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chemically synthesized short interfering RNA (siRNA) and a nonspecific control were purchased from RiboBio Co. Ltd. (Guangzhou, China). PRPF19-specific shRNA with the following target site was cloned in the lentiviral vector pLKO.1-puro (Addgene, catalog no. 8453). shPRPF19: 5′- CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTTG-3′ and 5′- AATTCAAAAAGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTC-3′.

Zhang L., Hao P., Chen X., Lv S., Gao W., Li C., Li Z, & Zhang W. (2024). CRL4B E3 ligase recruited by PRPF19 inhibits SARS-CoV-2 infection by targeting ORF6 for ubiquitin-dependent degradation. mBio, 15(2), e03071-23.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!