Antibodies used rat anti-Tropomyosin (1:400; Abcam, Ab-50567), mouse anti-Slit (1:1000; Developmental Studies Hybridoma Bank, The University of Iowa). Secondary fluorescent antibodies were purchased from Jackson Laboratories.
Secondary fluorescent antibodies
Manufactured by Jackson ImmunoResearch
Sourced in United States, United Kingdom
Secondary fluorescent antibodies are conjugated antibodies used in immunoassays and immunohistochemistry to detect and visualize target proteins or antigens. They bind to primary antibodies and emit fluorescent signals upon excitation, allowing for the detection and localization of the target molecules.
Automatically generated - may contain errors
Lab products found in correlation
Sp5 2 confocal microscope, by Leica (1 mentions)
Mab3402, by Abcam (1 mentions)
Chicken anti map 2 polyclonal antibody, by Abcam (1 mentions)
Mouse monoclonal anti actin antibody, by Merck Group (1 mentions)
Rabbit polyclonal anti actin antibody, by Merck Group (1 mentions)
Fluoromount g, by Southern Biotech (1 mentions)
Cd45 fitc, by BioLegend (1 mentions)
Cd11b apc cy7, by BioLegend (1 mentions)
Egm 2 bulletkit, by Lonza (1 mentions)
Bleomycin sulfate, by Merck Group (1 mentions)
Ml141, by Merck Group (1 mentions)
Gapdh, by Abcam (1 mentions)
Active cdc42 detection kit, by Cell Signaling Technology (1 mentions)
F4 80, by BD (1 mentions)
Ebm 2 culture media, by Lonza (1 mentions)
Meca 32, by BD (1 mentions)
Cd11b, by Abcam (1 mentions)
Mouse anti neun, by Merck Group (1 mentions)
Confocal microscope, by Olympus (1 mentions)
Rabbit anti mouse inos, by Abcam (1 mentions)
6 protocols using secondary fluorescent antibodies
1
Tropomyosin and Slit Antibody Staining
2
Immunofluorescence Staining of Astrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Astrocyte cultures were washed with PBS, fixed in paraformaldehyde 4% for 20 min at room temperature, washed in PBS (0.1 m ) and blocked 1 h in PBS containing albumin (4%). The following primary antibodies were used: mouse anti-glial fibrillary acidic protein monoclonal antibody (dilution 1:3 000; Merck Millipore, Billerica, MA, USA; MAB3402), chicken anti-MAP-2 polyclonal antibody (dilution 1:3 000; Abcam, Cambridge, UK; ab5392), rabbit anti-clathrin heavy-chain polyclonal antibody (1 μg ml−1; Abcam; ab21679), rabbit anti-actin polyclonal antibody (dilution 1:200; Sigma-Aldrich; A2066) and mouse anti-actin monoclonal antibody (dilution 1:1 000). Secondary fluorescent antibodies (dilution 1:600) were purchased from Jackson Immunoresearch (Bar Harbor, ME, USA). A counterstaining with DAPI (3 ng ml−1) was realized in some experiments. Confocal laser-scanning microscopy was performed using a Leica SP5 II confocal microscope (Leica, Wetzlar, Germany).
3
Immunostaining of Embryonic Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were fixed overnight in 4% paraformaldehyde (PFA) at 4°C and either embedded in OCT or paraffin, sectioned at 12 μm or 7 μm, respectively, and immunostained. OCT sections were washed in PBS and, if required, antigen retrieved (2100 Retriever, Aptum Biologics Ltd.), using 10 mM citrate buffer (pH 6), incubated in 5% serum at room temperature (RT), and then overnight at 4°C with primary antibodies (Table S2 ). Sections were washed in PBS, incubated with secondary fluorescent antibodies (used at 1-5 μg/ml; Jackson Laboratories or Thermo Fisher) for 2 h at RT, washed in PBS, post-fixed in 4% PFA, rinsed in water, and mounted with Fluoromount-G (Southern Biotech). Paraffin sections were immunostained for SOX9 and COL2 (Table S2 ) according to Blitz et al. (2013) (link).
4
Inhibition of Fibrosis and Inflammation in Hypoxia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FG-3019 (10 mg/kg) and control IgG (10 mg/kg)—both administered intraperitoneal every week at initiation of hypoxia exposure (Wang et al., 2011 (link))—were the kind gift of FibroGen Inc. (San Francisco, CA). Bleomycin Sulfate, ML141, and dichloromethylenediphosphonic acid disodium salt (clodronate) was purchased through MilliporeSigma. Lipids and cholesterol for liposome production were bought from Avanti Polar Lipids. EBM-2 culture media (Lonza), with EGM-2 bulletkit, was utilized for all in vitro experiments. Primer sequences are as follows: CTGF forward primer GGGAGAACTGTGTACGGAGC; CTGF reverse primer AGTGCACACTCCGATCTTGC; CD11b forward primer ATGGACGCTGATGGCAATACC; CD11b reverse primer TCCCCATTCACGTCTCCCA; 18S forward primer ACCTGGTTGATCCTGCCAGTAG; and, 18S reverse primer TTAATGAGCCATTCGCAGTTTC. Antibodies used in this study were: anti-GFP (Aves), MECA-32 (BD Biosciences), CTGF (BD Biosciences), CD11b (Abcam), F4/80 (BD Biosciences), CD31 (Santa Cruz Biotechnology), and GAPDH (Abcam). Antibodies for flow cytometry used in this study were: CD45 (FITC; BioLegend), CD11b (APC-Cy7; BioLegend), and IgG2 (isotype control; BioLegend). Active Cdc42 detection kit was purchased through Cell Signaling Technology. Secondary fluorescent antibodies were from Jackson Immunoresearch. Refer to Supplementary Table 1 for full details of antibody catalog number and dilutions.
5
Immunohistochemical Characterization of Ischemic Brain
6
Immunohistochemical Analysis of Mouse Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mice sagittal tissue sections from the anti-freezing medium were taken and then mounted onto the superfrost glass slides, air-dried for 1 h, and washed twice in distilled water 5 min each. To access epitopes slides were incubated at 65 • C (water bath) for 20 min in 10 mM Sodium citrate (pH 6) containing 0.05% Tween (Preheat buffer), followed by washes in Trizma base solution (TBS) and incubation overnight with primary antibodies for GABAR2a (Novus Biologicals; NBP2-36560), NPTX2 (Abcam, ab69858) and GLUR1 (Santa Cruz Biotechnology, sc13152). After washing for 3 times with TBS, secondary fluorescent antibodies (Jackson Immuno, UK) were incubated for 3 h followed by washes and nuclear staining with DAPI (4,6-diamidino-2-phenylindole). After washing, slides were mounted on aqueous mounting media. Chromagen immunostainig was conducted using biotynilated secondary antibodies, followed by horse-reddish peroxidase-bound streptavidin and 3,3 ′ -diaminobenzidine (DAB) as previously described (Marathe et al., 2015) . Slides were dehydrated and mounted using resinous mounting media.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!