Dharmafect duo

PC-3M-luc cells and DU145 cells were cultured in EMEM (Lonza, Basel, Switzerland, 12–125) supplemented with 10% FCS, 1% L-glutamine (Lonza, BE17-605E) and 1% penicillin-streptomycin (Lonza, DE17-602E). RNAi knockdown was performed using Dharmafect 2 (Thermo Scientific, Waltham, MA, USA, T-2002-01) in PC-3M cells and Dharmafect 4 (Thermo Scientific, T-2004-01) in DU145 cells using 25 nM siRNA according to the manufacturer's instruction. For knockdown of LSD1 the following siRNAs were used: siCtrl: 5′-AACGTACGCGGAATACTTCGA-3′ and siLSD1 5′-acacaaggaaag cuagaagaa-3′. For others siCtrl 5′-GAAAGTCCTAGATCCACACGCAAAT-3′, siLPAR6 5′-UCAGCAUGGUGUUUGUGCUUGGGUU-3′, siPXN 5′-CATACCCAACTGGAAACCACACATA-3′, siTLN1 5′-CATTGTACTTGATACGGCCAGTGAT-3′, siZYX 5′-CAGGGAGAAGGTGAGCAGTATTGAT-3′ and siPIK3R2 5′-CCCTCAGGAAAGGCGGGAACAATA-3′. Dharmafect Duo (Thermo Scientific, T-2010-01) was used for plasmid transfection as described in the manual. Puromycin (Sigma, St Louis, MO, USA, P8733, 5 μg/ml) was administered to cells 24 h post transfection. 293T cells were cultured in DMEM supplemented with 10% FCS, 1% L-glutamine and 1% penicillin-streptomycin. Viral production was performed as described.^{12 (link)} PC-3M cells were infected with FU-GFP or FU-GFP-LSD1 and subjected to migration assay 24 h post transduction.

The shRNA sequences were cloned into Promega pGeneClip vectors by PCR-based outward full vector amplification, followed by head-to-head ligation with the following PCR primer sequences:
SCRMBL control sequence (5′→3′):
Sense-oligo: tgtca ATAGCTCTAGTAGCGCTAGC gcagtctggagtttcaaaagtagac.
Anti-oligo: ggaag ATAGCTCTAGTAGCGCTAGC gagatcttgggcctctgcc.
CD95L sequence (5′→3′):
Sense-oligo: gagacATTAGGTGAGTTGAGGAGCTAcgcagtctggagtttcaaaagtagac.
Anti-oligo: gagacATTAGGTGAGTTGAGGAGCTAcgagatcttgggcctctgcc.
Sense-oligos were obtained containing a 5′-phosphorylation for ligation. Target sequences (reverse complement) are shown in upper case. All vectors were sequence verified before transfection. Transfection of U87-MG and U251-MG cells with sh[SCRMBL] or sh[CD95L] vectors was performed using Dharmafect Duo (Thermo Fisher Scientific) according to the manufacturer’s protocols. Transfected cells were selected starting 2 days after transfection using increasing amounts of puromycin over a period of 2 weeks and subsequently cultured in RPMI-1640 with 10% FBS and 1 μg/ml puromycin. Endogenous levels of CD95L in the sh[SCRMBL] and sh[CD95L] vector transfected cells were quantified by ELISA analysis of 50 μg whole-cell lysate proteins with an ELISA set-up developed at Apogenix using a calibration curve of APG293.