Hieff qpcr sybr green master mix no rox

Total RNA isolated with TRIzol (Takara Bio Inc., Otsu, Japan) according to the manufacturer’s instructions was reverse-transcribed into cDNA using Hifair II 1st Strand cDNA Synthesis Kit (YEASEN, Shanghai, China). Quantitative Real-time PCR was carried out using Hieff qPCR SYBR Green Master Mix (No Rox) (YEASEN, Shanghai, China) and the CFX96 Trademark Real-time PCR detection system (Bio-Rad, California, USA). The expression levels of CACNA1G, CACNA1H, ATF6, IRE1, PERK, CTSB, CTSD, LAMP2, MURF1 and Antrogin1 were examined with the primers (Sangon Biotech, China) listed in Supplementary Table 2.

The total RNA of kidney tissue was extracted by TRIeasy™ LS Total RNA Extraction Reagent (YEASEN, Shanghai, China, #19201ES60), and the mRNA of hybridoma cells was extracted by TurboCapture 96 mRNA Kit (Qiagen, #72251) according to the manufacturer’s instructions. The purity and concentration of the extracted RNA samples were detected by Nanodrop One. Reverse transcription into cDNA was performed using the Hifair^® II 1st Strand cDNA Synthesis Kit (YEASEN, #11141ES60). Then the 2 × Hieff^® PCR Master Mix (With Dye) kit (YEASEN, #10102ES08) was used to perform PCR with Eppendorf Mastercycle nexus GX2 PCR. The Cycle-pure kit (Omega, Norcross, GA, USA, #D6492-01) was used to purify PCR products. A Hieff^® qPCR SYBR Green Master Mix (No Rox) (YEASEN, #11201ES03) kit was used to perform qPCR with LightCycler^® 96 instrument (Roche, Basel, Switzerland). The 2^−ΔΔCt method was applied to calculate relative expression levels. Primer information is shown in Table S3.

The RNA was extracted using a total RNA extraction kit (LS1040, Promega, Madison, WI, United States). Following the manufacturer’s instructions, 1 µg of total RNA was reverse transcribed into cDNA using Hifair first Strand cDNA Synthesis SuperMix (11141ES10, Yeasen Biotech, Shanghai, China) for RT-qPCR analysis. Quantitative PCR was performed on a Lightcycler 96 (Roche, Basel, Switzerland) with Hieff qPCR SYBR Green Master Mix (No Rox) (11201ES03; Yeasen Biotech). The relative expression was calculated for each gene by the 2^−ΔΔCT method, normalized against GAPDH expression, and presented as fold changes relative to the control. The sequences of all the primers used in this study are shown in Supplementary Table S2.

In this study, Quantitative RT-PCR was used to detect the knockdown potency of siRNA. Total cellular RNA was extracted and the concentration of RNA was examined using TRIzoI reagent (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Reverse transcription was performed using Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Yeasen Biotechnology, China). Hieff® qPCR SYBR Green Master Mix (No Rox) (Yeasen Biotechnology, China) was used for qPCR. GAPDH was used as an internal reference gene. The primers used in this experiment were as follows: RDX(forward,5′-TGCACCTCGTCTGAGAATCA-3′; reverse,5′-CTCTAATTGTGCCCTTTCCAAC-3′); GAPDH(forward,5′-ACCACAGTCCATGCCATCAC-3′; reverse,5′- TCCACCCTGTTGCTGTA-3′). The reaction conditions were 95°C, 5min; 95°C, 10s; 60°C, 30s. After 40 cycles of amplification, the amplification curves and lysis curves were confirmed to be correct and then analyzed.

Total RNA was extracted from human NP tissues with TRIzol reagent (Thermo Fisher, USA), and extracted from rat NP cells with a Takara MiniBEST Universal RNA Extraction Kit (Takara, Japan) according to the manufacturer’s guidelines. First-strand cDNA was synthesized using Hifair® II 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA Digester Plus) (Yeasen Biotech, China). RT-qPCR was performed using a Bio-Rad real-time PCR system with Hieff® qPCR SYBR Green Master Mix (No Rox) (Yeasen Biotech) following the standard procedure. The sequences of primers used are shown in Table 1. The GAPDH housekeeping gene was used as the internal control.
Table 1

The sequences of primers of RT-qPCR

Gene Name	Forward/ Reverse	5′-3′Sequence	Size
LTα	Forward	CCTGGCTGCACTCGATGT	127 bp
	Reverse	GCGAAGGCTCCAAAGAAG
Caspase-3	Forward	CTGGACTGCGGTATTGAG	102 bp
	Reverse	GGGTGCGGTAGAGTAAGC
Caspase-1	Forward	CAGGAGGGAATATGTGGG	120 bp
	Reverse	AACCTTGGGCTTGTCTTT
MMP-3	Forward	ACCTATTCCTGGTTGCTG	105 bp
	Reverse	GGTCTGTGGAGGACTTGTA
Aggrecan	Forward	TGAAACCACCTCTGCATTCCA	96 bp
	Reverse	GACGCCTCGCCTTCTTGAA
Type II collagen	Forward	GTCACAGAAGACCTCACGCCTC	81 bp
	Reverse	TCCACACCGAATTCCTGCTC
GAPDH	Forward	TCAAGAAGGTGGTGAAGCAGG	115 bp
	Reverse	TCAAAGGTGGAGGAGTGGGT

Muscle tissue and C2C12 cells were lysed. And total RNA was extracted by TRIeasy™ LS Total RNA Extraction Reagent (YEASEN, #19201ES60) according to the manufacturer’s instructions. The purity and concentration of the extracted RNA samples were determined using Nanodrop One. Reverse transcription into cDNA was performed using the Hifair® II 1st Strand cDNA Synthesis Kit (YEASEN, #11141ES60). Then Hieff® qPCR SYBR Green Master Mix (No Rox) (YEASEN, #11201ES03) kit was used to perform qPCR with LightCycler® 96 instrument (Roche). The 2^−ΔΔCt method was used to calculate relative expression levels. The primers are listed in Table S1.