Stellaris rna fish

We designed 28 oligonucleotide probes, 18–26 bp in length, spanning the whole rat IGF-1 mRNA. Probes were fluorescently labeled with Quasar 570 (Stellaris RNA FISH, Biosearch Technologies, Petaluma, CA, USA) for imaging using a Carl Zeiss Axioscope-2 upright fluorescence microscope equipped with AxioVision3 software. To visualize IGF-1 mRNA in the cultured neurons or DRG tissue sections, we followed the protocol for adherent cells and frozen tissues (Stellaris RNA FISH, Biosearch Technologies, Petaluma, CA, USA). See Supplementary Information for more details. Twenty images per group with a magnification of 63X were captured. A culture/section group without any probe or treated with RNase A (50 µg/mL) for 30 min at 37 °C, prior to the hybridization step was used as a negative control.

The cells were seeded on a 24-well plate at the density of 6 × 10⁴ cells/well. When the cell confluence reached up to 60–70%, the cells were fixed by 4% paraformaldehyde containing 0.5% Triton X-100 for 10 min at room temperature followed by the blocking with 20 μL prehybridization solution (BREA-106, Beijing Biocreative Technology Co., Ltd., Beijing, China) per well at 37 °C for 30 min. Afterward, the cells were hybridized with Stellaris RNA FISH (Biosearch Technologies, Petaluma, CA, USA) probe hybridization solution targeting lncRNA GAS5 probes (lncRNA Gas5-1: gactcctacctcgaaaagac; lncRNA Gas5-2: agcaccatacctcacaggag) (NC sequence is scramble sequence) overnight at 37 °C under conditions void of light. The cells were then washed with washing solutions I, II, and III respectively at 42 °C. Subsequently, the cells were stained with 4′-6-diamidino-2-phenylindole (DAPI) solution for 10 min. Finally, the cell slides were sealed using anti-fluorescence quenching tablets (BIH0252, BioRike, Changsha, Hunan, China) and observed under a fluorescence microscope (Olympus, Tokyo, Japan).

To visualize lariat RNA species from intron 13 of the TAOK2 gene, Quasar570^®-labeled smRNA-FISH probes were ordered from Stellaris RNA-FISH (LGC Biosearch technologies). smRNA-FISH was performed according to the manufacturer’s instructions. Briefly, 1 × 10⁶ cells were fixed in 3.7% (vol./vol.) formaldehyde and then permeabilized in 70% ethanol at 4°C. For in situ hybridization, permeabilized cells were incubated with 1.25 μM probes in the hybridization buffer (10% formamide, 10% dextran sulfate, 1 mg/mL E. coli RNA, and 0.2 mg/mL BSA in 2X SSC) at 37°C overnight. Afterward, cells were washed sequentially with wash buffer A (10% formamide in 2X SSC), wash buffer B (0.1% triton-x-100 in 2X SSC), wash buffer C (1X SSC with 1 μg/mL DAPI), and 1X PBS. Finally, these cells were plated onto the coverslip and mounted in ProLong^™ Gold Antifade Mountant (Thermo Fisher Scientific). The mounted cells were imaged using Olympus IX81 inverted widefield microscope equipped with Hamamatsu Orca Flash 4.0 camera with 4 megapixels and a 100× 1.45NA oil objective lens. Single RNA molecule counting was done using ImageJ, and statistical analysis was conducted in R.