Rna easy isolation reagent kit

Total RNA was extracted from 293T cells using an RNA‐easy Isolation Reagent kit (R071; Vazyme Biotech, China). First‐strand cDNA was synthesized using (R212‐01, Vazyme Biotech). qPCR analysis was performed using SYBR Green Real‐Time PCR Master Mix (QPK‐201, Toyobo, Osaka, Japan) in a CFX Connect Real‐Time PCR System (Bio‐Rad, Hercules, CA, USA). Data were obtained via a standard curve analysis and normalized to an internal control gene (ACTB).

The mRNA expression levels of MUC1, MUC2, Zonulin, FABP2, Occludin, ZO-1 were determined using quantitative reverse transcription polymerase chain reaction (RT-qPCR). Total RNA was extracted using the RNA-easy Isolation Reagent kit (R701, Vazyme, Nanjing, China), and its purity, integrity and concentration were measured by NanoDrop (Thermo Fisher Scientific, Wilmington, NC, USA). Complementary DNA synthesis was performed from 1 μg of total RNA using a first-strand cDNA synthesis kit (K1622, Thermo Fisher Scientific, Wilmington, NC, USA) following the kit protocol. Primers were synthesized by Tsingke Biotech (Tsingke, Beijing, China), and the primer sequences are shown in Table 1. Fluorescence (SYBR Green Master Mix, A25742, Thermo Fisher Scientific, Wilmington, NC, USA) was measured using ABI Prism 7500 Real-Time PCR System (Applied Biosystems, CA, USA). The cycle conditions are 95°C for 3 min and 40 cycles of 95°C for 10 s, and 60°C for 30 s. Using GAPDH as the internal reference, the relative expression of gene mRNA was calculated using the 2^-ΔΔCt method.

Total RNA was extracted via the RNA-easy Isolation Reagent Kit (Vazyme, R701-01, Nanjing, China). Plant gene expression was quantified by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) performed under strict experimental designs (Supplementary Table S2). All the qRT-PCR analyses were conducted using primers (Supplementary Table S3) of high specificities, which were verified by the melting-curve method [22 (link)], and using the constitutively expressed EF1α gene as a reference [10 (link)]. The qPCR experiments were conducted on the ABI QuantStudio 3a 96 Real-Time PCR system (Thermo Fisher, Waltham, Massachusetts, USA) using the ChamQ^TM Universal SYBR^® qPCR Master Mix (Vazyme, Q711-02, Nanjing, China). Relative expression levels of the tested genes (IMPβ1, EIN2C, related variants, and defense response genes, listed in Supplementary Table S3) were quantified as ratios of their transcript amounts to the EF1α transcript quantity. Callose visualization was performed on leaves as previously described [11 (link)].

Total RNA was isolated from frozen tissues in liquid nitrogen and cell lines using RNA-easy isolation reagent kit (Vazyme, China) according to manufacturer’s instructions. RNA quantity and quality were evaluated by Nano Drop spectrophotometer (Nano Drop Thermo, Wilmington, DE). cDNA was synthesized by reverse transcription (RT) using Swescript RT I first strand cDNA synthesis kit (Servicebio, China). Divergent primers of hsa_circ_0032746 were synthesized by Generay company (Shanghai, China). β-actin and U6 were used as a reference gene. The primer sequence for β-actin were F: TGAGAGGGAAATCGTGCGTGAC and R: GCTCGTTGCCAATAGTGATGACC; hsa_circ_0032746 were F: CATCAAGAGGAAGCGGAAAC and R: AGGGGATTGAACTCATGTGC; miR-4270 were F: CGGGCTCAGGGAGTCAGG and R: CAGCCACAAAAGAGCACAAT, Stem loop Primer was GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCCTC; U6 were F: CTCGCTTCGGCAGCACA and R: AACGCTTCACGAATTTGCGT; MCM3 were F: CTTTCCCTCCAGCTCTGTCTA and R: TCACCAGGCTTCGCTTTATC. The expression level of the circRNAs was evaluated by qPCR using ChemQ Universal SYBR Green mix (Vazyme, China) following manufacturer’s instructions. Both target and reference genes were amplified in triplicate wells. And the relative level of each circRNA was calculated using 2^−△△Ct method.

Total RNA was extracted using the RNA-easy Isolation Reagent Kit (Vazyme, Nanjing, China). Reverse transcription from 1 μg RNA to cDNA was performed using the PrimeScript reverse transcriptase reagent kit (Takara, Shiga, Japan). Real-time PCR was performed with SYBR qPCR SuperMix Plus (novoprotein, Suzhou, China) on a QuantStudio 6 Flex Real-Time PCR System. Results were analyzed using the comparative Ct method normalizing to Actin. The primer sequences are shown in Additional file 1: Table S2.