Pmir report luciferase

Effectene transfection reagent was used for transfection (Qiagen). Renilla luciferase vector was used for transfection efficiency control. Firefly and Renilla luciferase activities were measured by dual-luciferase assays (Promega) using TD-20/20 Luminometer (Turner designs, Sunnyvale, CA, United States) (Du et al., 2014 (link)). The luciferase report vectors (pMIR-REPORT Luciferase) were purchase from Applied BIOSYSTEMS (Cat#: AM5795; Waltham, MA, United States). The construct was made by Emory Integrated Genomics Core. Since the Let-7c miRNA binding site on the 3′-UTR of Igf1 is located at 1,360–1,367, the custom-made vector (pLuc-Igf1-3 UTR) containing the firefly luciferase gene and the 3-UTR (1310-1417) of Igf1. The insert was cloned between the SpeI and HindIII of the multiple cloning sites.

Three fragments of mouse PSD95 (dlg4) mRNA 3′UTR [3′UTR-A(2491-2769nt), 3′UTR-B(2770-3048nt) and 3′UTR-C(3049-3327nt)] were cloned into pMIR-REPORT luciferase plasmid (GeneChem, China). For luciferase reporter assays, HT-22 cells were co-transfected with pMIR-REPORT luciferase plasmid with PSD95 3′UTR-A, -B and -C (500 ng/well), Cirbp plasmids (500 ng/well) or NC (control) plasmids (500 ng/well), and Prl-TK plasmid (50 ng/well) using Lipofectamine 2000 (Invitrogen, USA). The luciferase activity was determined with the Dual-Luciferase Reporter Assay System according to the manufacturer’s instructions as described [53 ].

Primers were designed with software oligo6.0 and primer5.0 according to sequence from Genbank (EF064716) and synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.(Shanghai, China). The sequences were upstream primer: 5′- GCGAAGCTTACCTGGGTGTTGGGAGGGCA −3′ and downstream primer: 5′- GCGACTAGTGGAGTGGATAGGCCACGGCG −3′. A Hind III and a Spe I restriction site (underlined) were introduced to the upstream primer and the downstream primer, respectively.
The partial sequences of 3′ UTR of PD1 gene, which contain putative miRNA-binding sites, were amplified from genomic DNA by PCR using Taq Polymerase and Taq PCR Mix (Xi'an Runde Biotechnoly Co., Ltd., Xi'an, China). The PCR products were recruited by kit from TiangenBiotech (Beijing) Co., Ltd. (Beijing, China) and were then inserted into vector pMIR-REPORT^TM Luciferase (Ambion) after digestion with Hind III and Spe I [TAKARA Biotechnology (Dalian) Co., Ltd. Dalian, China]. The constructs were confirmed by double enzyme digestion with Hind III and Spe I (TAKARA Biotechnology (Dalian) Co., Ltd. Dalian, China) and sequencing. According to genotypes of PD1 rs10204525 polymorphism, constructed vectors were named pMIR-A (containing allele A sequence) and pMIR-G (containing allele G sequence), respectively.

Two hundred and sixty-three base pairs of the EZH2 3′UTR sequence (Accession: NM_004456; bases 2450 to 2712 of the EZH2 transcript variant 1) were amplified by polymerase chain reaction (PCR) using primer set 1 (Table 1) to incorporate Sgf I and Not I restriction sites. The PCR product was inserted into the multiple cloning site (MCS) located downstream of the renilla luciferase reporter gene in the dual-luciferase reporter vector pmiR-RB-REPORT^TM Vector (RiboBio, Guangzhou, China) to generate p1. To construct p2, 263 bp of the EZH2 3′UTR sequence was amplified by PCR using primer set 2 (Table 1) and cloned into the luciferase reporter vector pMIR-REPORT^TM Luciferase (Ambion/Life Technologies, Grand Island, NY) between the Spe I and Hind III sites as previously reported11 (link). The artificially synthesized scrambled EZH2 3′UTR was cloned into the MCS of the pmiR-RB-REPORT^TM Vector or pMIR-REPORT^TM Luciferase to generate the negative control reporter constructs p1-scram and p2-scram, respectively.