Pmko 1 gfp vector

Empty vector or shRNA of PSMA3 (shPSMA3) were constructed using the pMKO.1 GFP vector purchased from Addgene (a gift from William Hahn). The inserted PSMA3 shRNA targeted the sequence: 5′-TAA AGC TTT TGA ACT AGA A-3′. The luciferase reporter construct, pEBS1⁴-LUC plasmid, which contained four EGR-1 binding sites, was provided by Dr. Seung-Joon Baek (University of Tennessee). Human p65 promoter (−999/+92) was generated by RT-PCR using human genomic DNA from HCT-8 cells with the following primers: 5′-AAG ACG AAT TCA GAG AAA ATA AAA A-3′ and 5′-TGC ACT ACA GAC GAG CCA TT-3′. The resulting 1,091 bp construct was cloned by Kpn1/Xho1 excision, and inserted in the sense orientation into the reporter plasmid, pGL4.14-SEAP-hygro, in which the luciferase gene cassette was replaced with the SEAP gene cassette through HindIII and HpaI excision followed by blunt end formation using DNA polymerase I (New England Biolabs, Ipswich, MA, USA). The flag-tagged SR-IkB expression vector has been described previously (43 (link)).

The shRNA sequences were either designed by the Broad Institute GPP Web Portal or reported previously (50 (link)). The retroviral shRNA library was constructed by inserting the mix of shRNA double-strand fragments with 5′-BamHI and 3′-EcoRI sticky ends into the pSIREN-RetroQ_mCherry retroviral vector, in which the puromycin-resistant gene of pSIREN-RetroQ (Clontech) was replaced by the mCherry sequence from the mCherry-pBAD vector (Addgene).
For the study of Bcl6–shRNA and Zdhhc2-shRNA, Bcl6–shRNA (5′- GATCCGCTGTCAAAGAGAAGGCTTTATTCAAGAGATAAAGCCTTCTCTTTGACAGCTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_GFP vector, in which the puromycin-resistant gene of pSIREN-RetroQ was replaced by the green fluorescent protein (GFP) gene sequence from the PMKO.1-GFP vector (Addgene), Zdhhc2-shRNA-2 (5′-GATCCGTGACAGATGCCAACTTATAATTCAAGAGATTATAAGTTGGCATCTGTCACTTTTTTGATATCG-3′) and Zdhhc2-shRNA-4 (5′-GATCCGCTACTCCTGCGGGACTAAATTTTCAAGAGAAATTTAGTCCCGCAGGAGTAGCTTTTTTGATATCG-3′) were inserted into the retroviral pSIREN-RetroQ_mCherry vector, and a scramble shRNA (5′- GATCCGTGCGTTGCTAGTACCAACCTATTCAAGAGATAGGTTGGTACTAGCAACGCACTTTTTTGATATCG-3′) was inserted into the retroviral pSIREN-RetroQ_mCherry vector as controls.