Iscript reverse transcription supermix for rt quantitative qpcr

RNA was isolated from TA using TRIzol Reagent (15596026, Invitrogen) according to the manufacturer's instructions. RNA was quantified using a NanoPhotometer (Implen, München, Germany). For reverse transcription, 500 ng of RNA was used with an iScript Reverse Transcription Supermix for RT‐quantitative qPCR (1708840; Bio‐Rad, Hercules, CA, USA). For qPCR, cDNA was diluted 1:10 and 5 μl of the diluted cDNA was loaded in a total volume of 20 μl of SYBR Green Supermix (172‐5124, Bio‐Rad) and run on a Bio‐Rad CFX Connect Real‐Time PCR System. The relative quantification of gene expression was determined by the comparative CT method and normalized to Gapdh. The following primers were used: Tgfb1 forward AACAACGCCATCTATGAGAAAACC; Tgfb1 reverse CCGAATGTCTGACGTATTGAAGAA; fibronectin (Fn1) forward AGGACTGGCATTCACTGATGTG; fibronectin (Fn1) reverse GTCACCCTGTACCTGGAAACTTG; αSMA (Acta2) forward GTACCACCATGTACCCAGGC; αSMA (Acta2) reverse: GCTGGAAGGTAGACAGCGAA; Gapdh forward AGGTCGGTGTGAACGGATTTG; Gapdh reverse TGTAGACCATGTAGTTGAGGTCA.

Total RNA from cultured cells was extracted using the NucleoSpin kits RNA XS and II (Macherey-Nagel). Isolation of total RNA from muscles was performed with TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. RNA was quantified using a NanoPhotometer (Implen). There was 1 μg of total RNA for each sample that was retrotranscribed with the iScript Reverse Transcription Supermix for RT-quantitative (q)PCR (Bio-Rad) in a total volume of 20 μl. For qRT PCR, cDNA was diluted 1:10 and 5 μl of the diluted cDNA was loaded in a total volume of 20 μl (iTaq Universal, Bio-Rad). Primers used are listed in Table S2. The relative quantification of gene expression was determined by comparative CT method, and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH).