Dmem f12

The cell line FaDu (HTB-43TM), derived from a squamous cell carcinoma (SCC) of the hypopharynx, and the human gingival fibroblast cell line HGF (derived from the histologically normal gingival biopsy; Cell Lines Service product number: 300703) were used in this study. The authenticated cell lines were purchased from the American Type Culture Collection (ATCC; Manassas, Virginia, USA) and CLS within the last five years. Homozygous deletion of SMAD4 was observed in FaDu cells [24 (link), 25 (link)]. SMAD4 gene depletion can induce autophagy. The protein level of SMAD4 was inversely correlated with autophagy in orthotopic tumour tissue samples [26 (link)].
The cell lines were grown in a Dulbecco’s Modified Eagle’s medium/Nutrient Mixture F-12 Ham (DMEM/F12, Biosera) supplemented with antibiotics (pen-strep) and 10% fetal bovine serum in a humidified atmosphere of 5% CO₂ and 95% air at 37 °C. Two passages before the experiment, cell harvest, or EVs isolation, the cell lines were washed with PBS and grown in a medium supplemented with Exosome-depleted FBS (GibcoTM, A2720801); hereafter referred to as exofree medium. The passages of all cell lines performed in our lab ranged from 5 to 15. All experiments were performed with mycoplasma-free cells. Mycoplasma was detected by PCR (primers MYCO_A: GGCGAATGGGTGAGTAACACG and MYCO_B: CGGATAACGCTTGCGACCTATG).

Samples of normal hamstring tendon were obtained from patients, average age 30 (19–45y), undergoing anterior cruciate ligament reconstruction with informed consent and in full compliance with UK HTA and MREC requirements and with the Helsinki Declaration of 1975, as revised in 1983. Tenocytes were derived by standard explant protocol (Torricelli et al., 2006). They were expanded in DMEM/F12 (Lonza, Cheltenham, UK) containing 10% foetal calf serum (FCS) (Biosera, Ringmer, UK) and maintained in DMEM/F12 5% FCS during statin treatment. Tenocytes were treated with 0.2–2 μM lovastatin (Sigma, Poole, UK) dissolved in dimethyl sulfoxide (DMSO) (Sigma) for different times. Furthermore the cells were incubated in the presence of 0.08 and 0.8 μM atorvastatin (Sigma) and 0.048 and 0.48 μM simvastatin (Sigma). The latter was dissolved before treatment in NaOH in ethanol. To reverse lovastatin‐induced changes 100 μM mevalonate (Sigma) was added back. Vehicle controls included DMSO for lovastatin and atorvastatin, NaOH in ethanol for simvastatin and ethanol for mevalonate. Cells were used at passage 4 or below as it has been reported that tenocytes may dedifferentiate at higher passages (Yao et al., 2006).

HEK-293T, MCF-7, MCF-10A, and MDA-MB-231 cell lines were obtained from the Cell Bank of the Iranian Biological Resource Centre (Tehran, Iran). MCF-7 and MDA-MB-231 were maintained in Dulbecco's modified Eagle medium (DMEM, Biosera, France) with 10 % fetal bovine serum (FBS) (Invitrogen, UK), penicillin (100 units/ml) and streptomycin (100 μg/ml). MCF-10A cells were cultured in mammary epithelial cell growth medium (MEGM; Lonza/Clonetics, Switzerland) supplemented with 100 ng/ml cholera toxin (CT) (Sigma-Aldrich, Germany), 10 μg/ml insulin (Sigma-Aldrich), 20 ng/ml epithelial growth factor (EGF) (Sigma-Aldrich), 0.5 μg/ml hydrocortisone (HC) (Sigma-Aldrich), 10 % FBS and 1 % penicillin-streptomycin. In the case of HEK-293T, cells were maintained in DMEM/F12 (Biosera, France) medium, supplemented with 1 % penicillin-streptomycin and 10 % FBS. All cell lines were kept in a 5 % CO₂ humidified incubator at 37 °C.

This study used two human colorectal cancer cell lines, HCT116 and Caco-2, and epithelial non-cancerous cells MCF-10A, obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). HCT116 cells were cultured in RPMI 1640 medium (Biosera, Kansas City, MO, USA) and Caco-2 in Dulbecco’s Modified Eagle’s Medium (DMEM). Both growth media were supplemented with antibiotic/antimycotic solution (Merck, Darmstadt, Germany) and 10% fetal bovine serum (FBS; Gibco, Thermo Scientific, Rockford, IL, USA). The MCF-10A cells were cultured in growth medium consisting of high-glucose Dulbecco’s Modified Eagle’s Medium F12 (DMEM F12; Biosera, Kansas City, MO, USA) supplemented with antibiotic/antimycotic solution, insulin (10 µg/mL final), EGF (final 20 ng/mL), hydrocortisone (0.5 µg/mL final)(all Merck, Darmstadt, Germany) and 10% fetal bovine serum. Cells were maintained in a humidified atmosphere containing 5% CO₂ at 37 °C. Before all experiments, cell viability was greater than 95%.

Cell culture and treatment were performed as before [4 (link)]. Briefly, the human epithelial breast cell line MCF12A and the breast cancer cell line MCF-7 were used. MCF12A cells were kindly donated from Dr V. Zoubourlis (National Hellenic Research Foundation, Greece), and they were grown in Dulbecco’s Modified Eagle’s/F12 medium (DMEM/F12, 1:1)(Biosera, Nuaille, France), with 5% equine serum (ES) (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), 20 ng/mL epidermal growth factor (Peprotech, Rocky Hill, NJ, USA), 0.5 μg/mL hydrocortisone (Sigma Aldrich, MO, USA, 0.1 μg/mL cholera toxin (Sigma Aldrich, MO, USA), and 10 μg/mL insulin (Sigma Aldrich, MO, USA). MCF7 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM/high glucose; Biosera, Nuaille, France), with 5% heat-inactivated fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin/streptomycin (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). For ccfDNA release experiments, cells were seeded into six-well plates and were incubated for 24 h in serum-free conditions. They were then washed twice with sterile phosphate-buffered saline (PBS; Hyclone, Fisher Scientific, Loughborough, UK) and were incubated in serum-free media for another 48 h. Medium was collected, and cells were collected after the use of trypsin/EDTA solution.

Human colorectal adenocarcinoma cell line Caco-2 was purchased from the American Type Culture Collection (ATCC). Cells were cultured in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F12 (DMEM-F12) with L-alanyl L-glutamine stable glutamine and was enriched with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin (all from Biosera, Boussens, France). Caco-2 cultures were maintained at 37 °C, 5% CO₂, in a humidified atmosphere, under sterile conditions. Cells were seeded in plastic 100 mm plates, at a density of 2 × 10⁶ cells.