CRISPR experiments were performed as previously described48 using Gene Knockout Kits v2 (Synthego) for human PIM1, -2, -3, and S100A8 (with each Kit containing a mixture of three target-specific, synthetic multi-guide sgRNA sequences and purified Cas9 nuclease) and Lipofectamine CRISPRMAX Cas9 Plus transfection reagent (Thermo Fisher, CMAX00008) according to the protocol (entitled “CRISPR editing of immortalized cell lines with RNPs using lipofection”) provided by Synthego. Non-targeting sgRNAs (Negative control scrambling sgRNA #1 and #2) were also purchased from Synthego and mixed at 1:1 before use. sgRNA/Cas9 reverse-transfection was performed in 24-well plates (3.9 pmol sgRNA + 3 pmol Cas9 per well), and the resulting heterogeneous populations of cells were expanded in 6-well plates. The sgRNA/Cas9-treated cells were used in downstream assays within ~six weeks of transfection to avoid the expansion of undesired cell populations. Each biological replicate was initiated by sgRNA/Cas9 transfection. We found that while MDA-MB-468 cells were readily amenable to CRISPR-based genetic manipulation, BT-20 cells and freshly isolated mouse CD11b + Gr1+ myeloid cells were not, due to transfection-induced excessive toxicities.
Gene knockout kits v2
Manufactured by Synthego
The Gene Knockout Kits v2 are a set of laboratory tools designed for precise gene editing and disruption. These kits provide a streamlined workflow and high-efficiency components to enable targeted gene knockouts in various cell types.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using gene knockout kits v2
1
CRISPR Editing of Cell Lines
2
CRISPR Editing of Cell Lines
3
Pooled Knockout Cell Line Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pooled knockout cell lines were generated by electroporating Cas9-guide RNA ribonucleoprotein (RNP) complexes into reporter K562 cells using an Amaxa 4D Nucleofector X Unit (Lonza) and the SF Cell Line 4D-Nucleofector X Kit S (Lonza). Gene Knockout Kits v2 (Synthego) composed of three unique guide RNAs per target were ordered for each gene of interest. Guide RNAs were resuspended in 10 mM Tris, 1 mM EDTA pH 8.0 to a final concentration of 100 µM. Cas9 RNPs were generated by incubating 0.6 µl SpyFi Cas9 (Aldevron) and 1 µl (3.2 µg) guide RNA per gene target at room temperature for 10 min before electroporation. 2 × 105 cells were resuspended in 20 µl Nucleofector Solution SF (Lonza), combined with the assembled Cas9 RNPs, and the cells were electroporated in a 16-well cuvette using program FF-120.
Variable guide RNA sequences included in the Synthego Gene Knockout Kits for RNF185, RNF5, and UBE2D3 were: CAGCCAAGGAUGGCAAGCAA (RNF185 #1), AAUGGCGCUGGCGAGAGCGG (RNF185 #2), CAGGCUGAUGACGGCAUCCU (RNF185 #3), GUCUCUCACCUGGGAUCCUG (RNF5 #1), UCUUCCACACCGUUUUCCAA (RNF5 #2), GGCUGGAGACACGGCCAGAA (RNF5 #3), UAGAGCAUUCUUGGAAGAUA (UBE2D3 #1), UGAGGGAAAAUACUUGCCUU (UBE2D3 #2), and CAGAAUGACAGCCCAUAUCA (UBE2D3 #3). A synthetic sgRNA against the AAVS1 safe-harbor locus served as a control guide (guide sequence: GGGGCCACUAGGGACAGGAU [Amrani et al., 2018 (link)]).
Variable guide RNA sequences included in the Synthego Gene Knockout Kits for RNF185, RNF5, and UBE2D3 were: CAGCCAAGGAUGGCAAGCAA (RNF185 #1), AAUGGCGCUGGCGAGAGCGG (RNF185 #2), CAGGCUGAUGACGGCAUCCU (RNF185 #3), GUCUCUCACCUGGGAUCCUG (RNF5 #1), UCUUCCACACCGUUUUCCAA (RNF5 #2), GGCUGGAGACACGGCCAGAA (RNF5 #3), UAGAGCAUUCUUGGAAGAUA (UBE2D3 #1), UGAGGGAAAAUACUUGCCUU (UBE2D3 #2), and CAGAAUGACAGCCCAUAUCA (UBE2D3 #3). A synthetic sgRNA against the AAVS1 safe-harbor locus served as a control guide (guide sequence: GGGGCCACUAGGGACAGGAU [Amrani et al., 2018 (link)]).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!