A 25 µl aliquot of the respective total HBV DNA sample isolated from cell lysate was digested with 1 µl plasmid-safe DNAse (Epicentre, E3101K, Madison, WI) to destroy all chromosomal DNA along with any linear form of HBV DNA. According to the manufacturer’s instructions, the reaction mix was incubated at 37 °C for 30 min to 1 h in order to digest the samples. Following the digestion, plasmid-safe DNAse was heat inactivated by incubating the samples at 70 °C for 30 min. The cccDNA was then purified using a DNA clean up and concentration kit (Zymo, Irvine, CA), eluted in 30 µl of sterile ddH2O, and the residual amount of DNA quantified using a Nanodrop spectrophotometer. This resulted in a 1–1.5 log drop in overall DNA concentration. Samples were either used immediately for HBV cccDNA quantification by qPCR or were stored at −20 °C.
Quantitation of HBV cccDNA was performed as follows. A 5 µl aliquot of HBV DNA either isolated from mouse serum or from liver DNA was used per reaction well. We used the following primers and probes: GTCTGTGCCTTCTCATCTGC (forward primer), AGTAACTCCACAGTAGCTCCAAATT (reverse primer), and probe FAM-TTCAAGCCTCCAAGCTGTGCCTTGGGTGGC-TAMRA. The final concentration of primers was 0.9 µM, 0.2 µM probe, and 4% DMSO. The following qPCR cycling was used: 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s, and 61 °C for 1 min.
Quantitation of HBV cccDNA was performed as follows. A 5 µl aliquot of HBV DNA either isolated from mouse serum or from liver DNA was used per reaction well. We used the following primers and probes: GTCTGTGCCTTCTCATCTGC (forward primer), AGTAACTCCACAGTAGCTCCAAATT (reverse primer), and probe FAM-TTCAAGCCTCCAAGCTGTGCCTTGGGTGGC-TAMRA. The final concentration of primers was 0.9 µM, 0.2 µM probe, and 4% DMSO. The following qPCR cycling was used: 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s, and 61 °C for 1 min.