Gs junior platform

Strains F2-382 and NIHS-28 were cultured overnight in brain-heart infusion broth (Eiken Chemical, Tochigi, Japan) at 37°C. Bacterial DNA was extracted using the phenol-chloroform extraction and ethanol precipitation methods [43 ,44 (link)]. For whole-genome shotgun sequencing, the GS Junior platform (Roche, Basel, Switzerland) was employed using a GS Junior Rapid Library Preparation Kit and a GS Junior emPCR Kit (Lib-L; Roche), according to the manufacturer’s protocol. The read sequences were used to construct a contig without a reference sequence by de novo assembly, using the GS De Novo Assembler (Roche). For this assembly, the program parameters were set to: seed step, 12; seed length, 16; seed count, 1; minimum overlap, 10; and minimum identity, 90.

Genomic DNA was extracted using the QIAamp DNA Micro Kit (Qiagen) following the manufacturer's protocol. To amplify the region of the BCR-ABL fusion, PCR was performed using the following primers: forward 5′- TCGTGTGTGAAACTCCAGACTGTC – 3′ and reverse 5′- TTGGGCTTCACACCATTCCCC – 3′. PCR products were purified using a High Pure PCR Product Purification Kit (Roche) and were sequenced by the Sanger method using each forward and reverse PCR primers.
The editing efficiency of the sgRNAs and the potential induced mutations were assessed using Tracking of Indels by Decomposition (TIDE) software (https://tide-calculator.nki.nl; Netherlands Cancer Institute), which only required two Sanger sequencing runs from wild-type cells and mutated cells.
To identify specifically the different generated mutations, total DNA of Cas9-edited cells were PCR-amplified, subcloned and transformed in bacteria. DNA from single clones were extracted with a QIAprep Spin Miniprep Kit (Qiagen) and sequenced by Sanger sequencing.
In parallel, Next Generation Sequencing (NGS) technology was employed with the same Sanger primers with the corresponding adapters added, to read each edited sequence individually. The amplicon libraries were sequenced on the GS Junior platform (454 Life Sciences, Roche, Branford, CT, USA) [57 (link)].

Phage nucleic acid was isolated using the High Pure Viral Nucleic Acid Kit (Roche Applied Science, Mannheim, Germany), according to manufacturer's instructions. The complete genome of ΦIK1 was sequenced by the shotgun full-sequencing strategy using the GS Junior+platform (Roche Diagnostics GmbH, Germany). The mean coverage of ΦIK1 was 1380. The assembly of the sequence was performed with Geneious 8 software. Reads were mapped against the ΦIK1 genome sequence and the coverage was investigated for detection of direct repeats. Open reading frames (ORFs) were predicted using RAST [18 (link)].