Thermoscript

cDNAs were synthesized from 36 UM and 51 CM samples preserved in TRIzol® reagent, following the manufacturer’s instructions. RNAs were treated with DNAse I (BioLabs, Ipswich, MA), and the absence of genomic DNA was assessed by 40 cycles of RT-PCR with fructose-biphosphate aldolase primers [29 (link)]. Reverse transcription of RNA was performed by Thermoscript® (Life Technologies) with random hexamers and oligo dt primers, following manufacturer’s recommendations.

The Primer ID was introduced using primer CH331, which contained an HIV-specific region, a Primer ID region and a region corresponding to the 454 adaptor B sequence (Fig. 1 and S1 Fig.). This primer, and all other primers, was standard desalted and purchased from IDT (Integrated DNA Technologies, Leuven, Belgium). The Primer ID consisted of 11 randomized nucleotides for a total of 4,194,304 combinations, which introduced a unique sequence tag into each cDNA molecule. The CH331 primer had thymidine bases replaced by uracil bases to allow downstream degradation by uracil-DNA glycosylase (UDG). For the SG3Δenv plasmid DNA the Primer ID was introduced by using the CH331 primer in a single PCR cycle with Platinum Taq High Fidelity (Life Technologies, Stockholm, Sweden) and the PCR conditions below. For the patient plasma samples the Primer ID was introduced by cDNA synthesis using the CH331 primer. For denaturation and priming extracted RNA (8 μl) and primer was incubated at 65°C for 5 min followed by a short incubation at 4°C. Next, Thermoscript (Life Technologies, Stockholm, Sweden) was added and cDNA synthesized by incubation at 42°C 15 min, 50°C 30 min, 85°C 5 min and finally 4°C according to the according to the manufacturer’s instructions. cDNA synthesis was done in five parallel reactions to allow reverse transcription of all available RNA.

Total RNA was isolated with TRIZOL (ThermoFisher) from a single brain hemisphere of a mixed C57BL/6 background adult mouse. 5 μg total RNA was annealed to random hexamer primers and reverse transcribed with Thermoscript (ThermoFisher) according to the manufacturer’s protocol. KCTD2, KCTD5, and KCTD17 transcripts were amplified using primer pairs oNS286 and oNS287, oNS288 and oNS289, and oNS290 and oNS291, respectively.
For in situ hybridization, DNA templates bearing a terminal SP6 promoter for in vitro transcription were generated by PCR amplification of C57BL/6 mouse genomic DNA, using primer pairs oNS1204 and oNS1205 for KCTD2, oNS1207 and oNS1208 for KCTD5, and oNS1213 and oNS1214 for KCTD17. Riboprobes were transcribed with SP6 polymerase and DIG-11-UTP or Fluorescein-12-UTP (Roche). In situ hybridization was performed as described [70 (link)], amplifying Fluorescein- and DIG-labeled probes with Fluorescein-tyramide and Cy5-tyramide (Perkin Elmer) respectively.

Specific amplification of HCV minus strand RNA was performed as previously described 42, modified for Taqman realtime PCR. cDNA of the HCV minus strand was generated by reverse transcription using thermoscript (Thermo Fisher Scientific) and primer tag‐RC1 (5′‐ggccgtcatggtggcgaataaGTCTAGCCATGGCGTTAGTA‐3′) according to manufacturer instructions. Subsequently the tagged minus strand cDNA was amplified and detected by realtime Taqman PCR using a tag‐specific primer, RC21 (5′‐CTCCCGGGGCACTCGCAAGC‐3′), and FAM‐labelled Taqman probe HCV‐5UTR (5′‐CTCCCGGGAGAGCCATAGTGGTCTGCG‐3′) using LC480 Probesmaster (Roche Applied Science) according to manufacturer instructions. PCR conditions were as follows: two minutes at 50°C and ten minutes at 95°C, followed by 45 cycles each consisting of fifteen seconds at 95°C and one minutes at 60°C. Ct values above 36 were considered background, based on negative control experiments.

XNA reverse transcription was primed using DNA or mixed DNA-2’-O-methyl-RNA primers (Supplementary file 3). ANA was reverse transcribed using RTI521L as described previously (Pinheiro et al., 2012 (link); Taylor and Holliger, 2015 (link)). HNA and AltNA were reverse transcribed using a novel polymerase, polTK², which will be described elsewhere. XNA RT reactions were isolated using streptavidin beads as described previously (Taylor and Holliger, 2015 (link)), prior to amplification using OneTaq hot-start master mix (NEB), or a blend of OneTaq and ThermoScript (Thermo Fisher), with appropriate primers (Supplementary file 3).