Miniopticon

Samples were tested with the QuantiFast Pathogen RT-PCR Kit and reagents (Qiagen Inc., CA, USA) using RT-qPCR to amplify a 114bp region of the CDV phosphoprotein (P) gene as described above. In addition to the primers and probe concentrations listed above, each 25 μL PCR reaction contained the following: 2 μL of RNA template, 12.5 μL of DNase/RNase-free water, 5 μL of 5x master mix, 0.25 μL of 100X reverse transcriptase, 2.5 μL of 10X IC RNA and 2.5 μL of IC (inhibition control) mix. Samples were tested on the Bio-Rad MiniOpticon^™ with the following cycling conditions: 50 °C for 20 minutes, 95 °C for 5 minutes, followed by 45 cycles of 95 °C for 15 seconds, 60 °C for 30 seconds (data collection step), and then held at 12 °C. A no-template negative control and plasmids containing the primer binding sites for the CDV P gene were included as negative and positive controls, respectively.

DNA extracts of pools of three specimens of sibling species were screened for P. falciparum and Plasmodium vivax, and Plasmodium knowlesi and were performed with a MiniOpticon real time PCR system (Bio-rad, CFX Manager 3.0 software). For the screening of P. falciparum and P. vivax, the sequences of the primers were provided by NCGM (National Center for Global Health and Medicine, Japan) and are described in Canier et al. [21 (link)], but with a modification for the RTPCR Screening2_R primer (TTGCACCCCAATARCTCATTT). For P. knowlesi, the primers were developed during the study (PkF: GAG TT A TTG GGG TGC AAC TGT C and PkR (CTG TAT ATC CTC CAC ATAACC AAA TG). Reactions were conducted using 9.5 μL of SYBR Green Super Mix (Bio-rad), 0.25 μL of each primer F and R and 2 μL of DNA template for a total reaction volume of 20 μL. The thermocycling protocol was 95 °C for 3 min followed by 40 amplification cycles at 95 °C for 10 s, 60 °C for 30 s and dissociation. Positive pools were confirmed with the melt curve analysis. Positive controls were provided by NCGM from mosquitoes artificially-infected with P. falciparum and P. vivax. These infected mosquitoes were extracted in the same condition as the samples used in this study. All positive samples were confirmed for Plasmodium species by sequencing (NCGM, Japan).

DSF experiments were performed in 48-well plates using 50 µL reactions consisting of 2 µg of purified TAPBPR protein and 5x SyPRO orange dye (Invitrogen molecular probes, Thermo Fisher Scientific) in PBS pH 7.4. The melt curve was performed using Bio-Rad MiniOpticon reverse transcription-polymerase chain reaction (RT-PCR) thermal cycler between 20°C and 95°C in 1°C steps with 20 s equilibration time per step. The protein melting temperature (T_m) was taken as the inflexion point of the sigmoidal melting curve, obtained by curve fitting using DSF scripts (Niesen et al., 2007 (link)) and GraphPad Prism software.

BMMs were activated as indicated, and total RNA was isolated by using TriZol reagent (Invitrogen, UK) or an RNeasy Mini Kit (Qiagen, Germany). cDNA was synthesized, and the transcripts were amplified by using a Mini-Opticon or CFX Connect^™ real-time PCR detection system (Bio-Rad, USA). The primer sequences used are provided in S1 Table. The expression of each gene was normalized to the expression of β-actin by the 2^-ΔΔCT method.

The total RNA was isolated with the TRIzol reagent. A cDNA was synthesized using a reverse transcription kit. PCR was performed in a qPCR device (MiniOpticon, Bio Rad) with the SYBR green PCR Master Mix. The cycle time values of the genes of interest were first normalized with β-actin of the same sample, and then the relative difference between control and each treatment group was calculated and expressed as a relative value. Primers using in the present study include: Bcl6 (acaccaccagcctcttatcc and ggcgagtagatgttgctgtg), IL-10 (ggtgagaagctgaagaccct and tgtctaggtcctggagtcca), IgE (atccagacagtgtgaagggg and tgactgaggttccttgaccc) and β-actin (gtgggaatgggtcagaagga and tcatcttttcacggttggcc).