The MEGAshortscript kit (Life Technologies) and pTRI-β-actin-human template (Life Technologies) were used to in vitro transcribe a 309-nt actin RNA transcript that was subsequently cap-labeled using recombinant VACV guanylyltransferase/guanine-7-methyltransferase (Epicentre Biotechnologies) in conjunction with capping buffer (50 mM Tris-HCl pH 8.0, 6 mM KCl, 1.25 mM DTT, 1.25 MgCl2), 0.132 μM [α32P] GTP, and 0.1 mM S-adenosylmethionine [28 (link)]. The cap-labeled RNA was then purified from unincorporated nucleotides by using a ProbeQuant G-50 gel filtration column (GE Healthcare).
Probequant g 50
Manufactured by GE Healthcare
Sourced in United States
The ProbeQuant G-50 is a compact, benchtop liquid scintillation counter designed for quantitative analysis of radioisotopes in biological and environmental samples. It features a sensitive detection system and user-friendly software interface for efficient data collection and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Recombinant vacv guanylyltransferase guanine 7 methyltransferase, by Illumina (1 mentions)
Megashortscript kit, by Thermo Fisher Scientific (1 mentions)
Paraformaldehyde (pfa), by Electron Microscopy Sciences (1 mentions)
Dig rna labeling kit, by Roche (1 mentions)
T4 pnk, by New England Biolabs (1 mentions)
5 protocols using probequant g 50
1
In vitro Transcription and Cap Labeling of Actin RNA
2
Whole Mount In Situ Hybridization of SART1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA probe was synthesized from the PCRII TOPO vector containing the 2.5 kb sart1 fragment as mentioned above using the DIG RNA Labeling Kit (SP6/T7) (Roche, Basel, Switzerland). A probe for deltaC was also synthesized to use as a control. The probes were purified using the illustra Probe Quant G-50 micro columns (GE Healthcare, Chicago, IL, USA) and resuspended in 80 µL hybridization buffer. Hybridization buffer was prepared as described in Thisse and Thisse [11 (link)]. Probes were analyzed on a 1% agarose gel to determine the quality of the RNA. cp27.5 wild-type and mutant larvae were collected at 3 dpf, anesthetized in 0.02% tricaine, and fixed in 4% paraformaldehyde (PFA) (Electron Microscopy Sciences, Hatfield, PA, USA). Larvae were stored at 4 °C for 16 h overnight. The whole mount in situ hybridization protocol was performed as previously described in Thisse and Thisse [11 (link)].
3
Oligonucleotide Labeling and G4 DNA Substrate Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Substrates were made by 5΄-end labeling the oligonucleotides indicated in Supplemental Table S1 with T4 polynucleotide kinase (T4 PNK; NEB) and γ[32P]-ATP. Labeled oligonucleotides were separated from free label using illustra ProbeQuant G-50 micro columns (GE Healthcare) following the manufacturer's instructions. Oligonucleotides were annealed by incubating complementary or partially complementary oligonucleotides overnight at 37°C in Annealing Buffer (20 mM Tris–HCl [pH 8], 4% glycerol, 0.1 mM EDTA, 40 μg/ml BSA, 10 mM DTT and 10 mM MgOAc) (30 (link)). The G4 DNA substrate was folded by incubating oligonucleotide MB819 (Supplemental Table S1 ) in 1 M NaCl at 60°C for 48 h. The folded product was 5΄-end labeled as above and gel-purified on an 8% 19:1 acrylamide:bis-acrylamide gel run in 1× TBE buffer (90 mM Tris–HCl [pH 8.0], 90 mM boric acid, and 2 mM EDTA [pH 8.0]) at 10 V/cm. The gel slice containing the folded G4 substrate was placed into a microcentrifuge tube containing TBE buffer, and the DNA was allowed to diffuse into the buffer overnight at room temperature. The G4 DNA was then ethanol-precipitated and resuspended in 1× TE buffer (90 mM Tris–HCl [pH 8.0] and 2 mM EDTA [pH 8.0]).
4
Random Priming Labeling of DNA Probe
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The probe was labeled by random priming as follows. A 750-bp DNA probe corresponding to the 5′ end of the ARG2 gene was amplified using oligonucleotides AR1 (AGGAGAATATTCGCGCATGAA) and AR2 (AAGATATCTCATCTTTTTTAACGT). After gel purification, 50–60 ng of this PCR product were mixed with 150 pmoles poly-deoxynucleotides hexamers (pd(N)6, Takara) in 15 μl of 1× random priming buffer (500 mM Tris–HCl (pH 7), 100 mM MgSO4, 1 mM DTT). This mix was denatured at 95°C for 5 min before being put on ice. To this denatured DNA, 3 μl of α 32 P dATP (6000 Ci/mmol), 1 μl of the three remaining dNTP (10 mM each) and 10 units of Klenow polymerase fragment were added. The probe was incubated at 37°C for 1 h, then denatured 5 min at 95°C before being added to the hybridization buffer. Alternatively, it could be purified on ProbeQuant G50 micro sepharose columns (GE Healthcare) to allow probe quantification. Specific activities ranged from 6, 3×107 to 1, 4×109 cpm/μg DNA, depending on the probe (mean ± 99% confidence interval = 5, 6×108 ± 1, 9×108). The whole labeled probe was used in each hybridization (3 000 000 cpm on the average).
5
DNA Substrate Preparation and Annealing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Substrates were 5'-end labelling with T4 polynucleotide kinase (T4 PNK; NEB) and g-[ 32 P]-ATP. Labelled oligonucleotides were separated from free label using illustra ProbeQuant G-50 micro columns (GE Healthcare) following the manufacturer's instructions. Oligonucleotides were annealed by incubating complementary or partially complementary oligonucleotides overnight at 37 C in Annealing Buffer (20 mM Tris-HCl [pH 8], 4% glycerol, 0.1 mM EDTA, 40 mg/mL BSA, 10 mM DTT, and 10 mM MgOAc) [4] . The sequences of the oligonucleotides used to make DNA substrates are listed in Supplementary Table 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!