Superscript 3 system

Human and mouse RNA was extracted from snap-frozen sorted cell pellets using a RNeasy Micro Kit (Qiagen), and DNase treatment was performed using the TURBO DNA-free Kit (Ambion) according to the manufacturer’s instructions. RNA sequencing was performed on an Illumina HiSeq at the Australian Genome Research Facility. Per human sample, 16–26 million 100 bp single-end reads were generated, and 13–17 million 100 bp single-end reads were generated per mouse sample. For human qPCR analyses, cDNA was generated using the SuperScript III system (Life Technologies) and subject to qRT-PCR using the Sensimix SYBR Hi-Rox kit (Bioline) on the Rotorgene RG-6000 (Corbett Research) under standard conditions. Three technical replicates were performed for each sample. Taqman gene expression assays were used for MUC5AC (Hs0087365_mH) and FOXJ1 (HS00230964_m1) using 18S (HS99999901_s1) or GAPDH (HS99999905_m1) as reference genes (Life Technologies). The sequence of the primers is available in S1 Table.

A set of 21 human cDNA samples from different healthy organs was used to study the tissue pattern of SERPINB3 and B4 expression. Except for the first-strand cDNA from leukocytes (Clontech), the RNA from the First Choice Human Total RNA Survey Panel (Ambion) was used as a template to generate cDNA by RT- PCR using a Superscript III system (Life Technologies). PCR amplification was performed using the primers 5′ – TGTAGGACTCCAGATAGCAC – 3′ and 5′- TGTAGGACTTTAGATACTGA – 3′, designed to be unique to the target SERPINB3 and B4 cDNA, respectively, and primer 5′ - TGGAAATACCATACAAAGGCA – 3′. GAPDH was employed as control using primers 5′ - TCAAGGCTGAGAACGGGAAG - 3′ and 5′ - AGAGGGGGCAGAGATGATGA - 3′ for amplification (see Fig. S1).

In total, 300.000 cells/well were seeded into 6-well plates and, the following day, were treated with 50 nM calcitriol for 24 h or 48 h. Experiments were performed using 3 biological replicates for each treatment condition, while the experiment was repeated three times. RNA was isolated using the ExtractMe Total RNA Kit (Blirt S.A., Gdanks, Poland), while 1–2 µg RNA was used for cDNA synthesis. SuperScript III System (Life technologies, Darmstadt, Germany) allowed the synthesis of cDNA, whereas 100 U per sample was sufficient. The quantitative Real-Time PCR (qRT-PCR) was performed using Taqman probes (Applied Biosystems, Darmstadt, Geramany), Fast-Start Universal Probe Master Mix (Roche) on a StepOne Plus System (Applied Biosystems) in a 20 µL reaction volume. Ct values were normalized to TATA box-binding protein (TBP). Fold-change in gene expression was determined by 2^−∆∆Ct method, except for VDR-expression, whereas the expression was determined using the 2^−∆Ct method.
The following Taqman-probes were used: BLC2 (Hs00608023_m1), CCND1 (Hs00765553_m1), CYP24A1 (Hs00167999_m1), GFAP (Hs00909233_m1), GLI1 (Hs00171790_m1), OLIG2 (Hs00300164_s1), SOX2 (Hs01053049_s1), SOX9 (Hs00165814_m1), TBP (Hs00427620_m1), TNC (Hs01115665_m1), VDR (Hs00172113_m1)

RNA-Isolation was conducted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) in combination with the QiaShredder Kit or the ExtractMe Total RNA Kit (Blirt S.A., Gdansk, Poland) according to the manufacturer’s instruction. cDNA-Synthesis was achieved using the SuperScript III System (Life Technologies, Darmstadt, Germany) according to the manufacturers instruction using 100 U SuperScript per sample. The quantitative Real-Time PCR (qRT-PCR) was performed using 20× Taqman Probes (Applied Biosystems, Darmstadt, Germany) and 2× Fast-Start Universal Probe Master Mix (Roche, Mannheim, Germany) on a StepOne Plus System (Applied Biosystems) using the standard setting. The target gene expression values were normalized to the reference gene TATA-box binding protein (TBP). A list of all FAM-MGB probes is provided as a Supplemental file (Supplement File 1).

Real-time RT-qPCR was done using the same RNA samples that were used for sRNA-blot analysis, essentially as described (24 (link)). Briefly, two micrograms of DNaseI-treated total RNA served to produce first-strand complementary DNA using the SuperScript III system (Life Technologies). RT-qPCR was done on optical 96-well plates in the 7500 Fast Real-Time PCR System (Applied Biosystems) using the following program: 20 s at 95°C, followed by 40 cycles of 95°C for 3 s and 60°C for 30 s, with an additional melt curve stage consisting of 15 s at 95°C, 1 min at 60°C and 15 s at 95°C. The 20-μl reaction mixture contained 10 μl of 2× Fast SYBR Green Master Mix (Applied Biosystems), 2 ml of diluted complementary DNA (1:5) and 300 nM of each gene-specific primer. Primers used for RT-qPCR are listed in Supplementary Table S7. Target mRNA expression levels were calculated relative to four Arabidopsis reference genes (ACT2, CBP20, SAND and UBQ10) using the delta delta cycle threshold comparative method (Applied Biosystems) of the 7500 Fast Software (version 2.2.2; Applied Biosystems). Three independent biological replicates, and two technical replicates for each biological replicate were analyzed.

Total RNA extraction was performed using the TRIzol^® (Ambion) protocol, followed by precipitation using 0.8 M sodium citrate, 1.2 M NaCl and isoproponol, a second precipitation using 8 M LiCl, and a third precipitation with 3 M NaAc pH 5.2 and 100% ethanol. Subsequently, a DNase I (Life Technologies) treatment was performed according to manufacturer’s specifications, and RNA was recovered using phenol/chloroform extraction followed by a precipitation with 3 M NaAc pH 5.2 and 100% ethanol. RNA was resuspended in 10 μl of DEPC water and quantified by measuring its absorbance at 260 nm. RNA integrity was evaluated by the 260/280 and 260/230 ratios, and confirmed by agarose gel electrophoresis.
cDNA was synthesized from 1.3 μg of total RNA using the SuperScript^® III System (Life Technologies). In summary, total RNA was mixed with 1 μl of oligo dT (50 μM), 1 μl of dNTPs (10 μM) and MQ water, giving a total volume of 14 μl, and incubated for 5 min at 65°C and then chilled on ice. Subsequently, 4 μl of First Strand Buffer (5x), 1 μl of DTT (0.1 M) and 1 μl of SuperScript reverse transcriptase III (200 units/ μl) were added, each reaction was incubated for 2 h at 50°C and, finally, inactivated for 5 min at 70°C. cDNA was diluted 1:50 for use in quantitative real-time PCR experiments.