Mission non target shrna control vector shc002

Hsp27 knockdown (Hsp27-KD) cells were generated using Hsp27-specific short hairpin RNA (shRNA) (National RNAi Core Facility, Academia Sinica, Taiwan) as previously described [20 (link), 38 (link)–41 (link)]. The target sequence for the human Hsp27 mRNA (NM_001540) was 5′-CCGATGAGACTGCCGCCAAGT-3′. The MISSION non-target shRNA control vector (SHC002) was used as a scrambled control (Sigma Chemical Co.) [38 (link)–41 (link)]. HCC cells were transfected with the knockdown vector or the parental vector (pLKO.1<-puro) and then selected with puromycin. The transfection and generation of stably transfected cell lines were performed as previously described [40 (link)–42 (link)].

PECs at passage six were transduced with a lentivirus encoding for an anti-Cd9 small-hairpin RNA (shRNA) (sh-Cd9) or a scramble shRNA (sh-scramble) at a dose of 20 multiplicity of infection (MOI). Medium containing lentiviral particles was replaced by fresh medium after 1 day. Cells were analyzed at least 7 days post transduction. Production of HIV1 delta U3 SIN lentiviral particles with VSV-G envelop was carried out by the VVTG facility platform (Necker faculty) by using the lentiviral vector TRC1-pLKO.1-U6- shRNACd9 (MISSION shRNA, SHCLND NM_007657, TRCN0000066393, Sigma Aldrich) containing Cd9-specific shRNA (sequence: CCGGCCTGCAATGAAAGGTACTATACTCGAGTATAGTACCTTTCATTGCAGGTTTTTG) or the control vector (MISSION NON-TARGET SHRNA CONTROL VECTOR, SHC002, Sigma Aldrich).