The sections (10μm thick) were fixed in 4% paraformaldehyde in PBS (10 mM phosphate, pH 7.4) for 10 min after deparaffinization. Endogenous peroxidase was blocked in 3% H2O2/PBS for 15 min and permeabilized with PBS containing 0.1% Triton X100 for 30 min. The slides were rinsed three times in PBS-Tween 20 for 5 min each. After rinse, the sections were incubated with serum blocking solution for 1 hr. and subsequently incubated with the primary antibodies, ZEB2 (1:50, SIP1, polyclonal goat anti-human, SC-18392, Santa Cruz) and Clone E29 (1:100, monoclonal mouse anti-human epithelial membrane antigen, Dako) in blocking buffer for 3 hr at room temperature. The sections were washed three times in PBS-Tween 20 (0.1%) for 5 minutes. Alexa fluor 488-conjugated anti-goat IgG (1:1000, Invitrogen) and Cyanine 3 anti-mouse (1:1000, Jackson ImmunoResearch) were used as secondary antibody for 1hr at room temperature. Nuclei counterstaining was performed with 300 μl 4,6-diamidino-2-phenylindole (DAPI) per slide for 1 min. Coverslips were mounted with anti-fade fluorescent mounting medium. All images were visualized on LSM700 Confocal microscope with ZEN software.
Cyanine 3 anti mouse
Manufactured by Jackson ImmunoResearch
Sourced in United States
Cyanine 3 anti-mouse is a fluorescent dye-labeled secondary antibody produced by Jackson ImmunoResearch. It is designed to detect and bind to primary antibodies raised in mice.
Automatically generated - may contain errors
Lab products found in correlation
Alexa fluor 488 conjugated anti goat igg, by Thermo Fisher Scientific (1 mentions)
Lsm700 confocal microscope, by ZenBio (1 mentions)
Clone e29, by Agilent Technologies (1 mentions)
Iba1 antibody, by Fujifilm (1 mentions)
Alexa 488 anti rabbit, by Jackson ImmunoResearch (1 mentions)
Fluorescence microscope, by Nikon (1 mentions)
Biotinylated secondary antibody, by Thermo Fisher Scientific (1 mentions)
Bx60 epifluorescence microscope, by Olympus (1 mentions)
Dapi fluoromount, by Southern Biotech (1 mentions)
Orca er cooled ccd camera, by Hamamatsu Photonics (1 mentions)
Anti chicken alexa fluor 488, by Jackson ImmunoResearch (1 mentions)
Anti rabbit cyanine 3, by Jackson ImmunoResearch (1 mentions)
Dylight 649 anti mouse, by Jackson ImmunoResearch (1 mentions)
Alexa 488 conjugated streptavidin, by Thermo Fisher Scientific (1 mentions)
Anti goat alexa 647, by Thermo Fisher Scientific (1 mentions)
5 protocols using cyanine 3 anti mouse
1
Immunofluorescent Staining of ZEB2 and EMA
2
Immunohistochemical Analysis of Spinal Cord
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As we previously reported [19 ], we used isoflurane to anesthetize mice and perfuse with saline and 4% paraformaldehyde through the ascending aorta. After perfusion, the cervical skin and the C3-4 spinal cord segment were taken and fixed overnight. The spinal cord section (30 μm, free-floating) was cut in a cryostat and subjected to immunohistochemical treatment. Firstly, block the sections with 2% goat serum at room temperature for 1 h, then incubated overnight at 4 °C with the primary antibodies: Iba-1 antibody (1:1000, rabbit; Wako, catalog: 019-19741), GFAP antibody (1:1000, mouse; Millipore Bioscience Research reagent, catalog: MAB360), using PBS repeatedly wash 3 times then Cyanine 3-anti-mouse (1:1000, Jackson ImmunoResearch, catalog: 115-165-003) or Alexa 488-anti-rabbit (1:1000, Jackson ImmunoResearch, catalog: 111-545-003) mixture incubated for 2 h at room temperature. Check the stained section with the Nikon fluorescence microscope, and capture the image with a CCD Spot camera. Six spinal cord slices were collected from each mouse for quantitative immunofluorescence. The blind observer using ImageJ software to measure the fluorescence intensity of the superficial dorsal horn of the spinal cord (laminae I-III).
3
Quantitative Analysis of DARPP-32 and Huntingtin Aggregates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Coronal sections (30 μm) of the whole brain were obtained. Anti-DARPP-32 (1:1000; BD Bioscience, San Jose, CA, USA) antibody was used for free-floating immunofluorescence that was performed as described elsewhere (Rué et al., 2016) . After primary antibody incubation, slices were washed three times and then incubated for 2 h shaking at room temperature with Cyanine-3 anti-mouse (1:300; Jackson Im-munoResearch, West Grove, PA, USA). Nuclei were stained with DAPI -Fluoromount (SouthernBiotech, Birmingham, AL, USA). DARPP-32 striatal staining was examined and photographed at 2× using an Olympus BX60 epifluorescence microscope (Olympus, Tokyo, Japan) equipped with an Orca-ER cooled CCD camera (Hamamatsu Photonics, Hamamatsu, Japan). Anti-EM48 (1:150; Millipore, Billerica, MA, USA) antibody was used for htt aggregates detection. Sections were incubated with biotinylated secondary antibody (1:200; Thermo Fisher, Rockford, IL, USA), and developed with Diaminobenzidine (DAB), as previously described (Anglada-Huguet et al., 2014) . DARPP-32 and EM48 stainings were examined in 8 slices per animal separated by 240 μm (covering the entire striatum or CA1 hippocampal regions) by using Computer-Assisted Stereology Toolbox (CAST) software (Olympus Danmark A/S). All images were analyzed using CellProfiler Analyst software (Jones et al., 2008) .
4
Immunofluorescence and FISH Labeling Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-chicken Alexa Fluor® 488 (703-546-155, Jackson ImmunoResearch), anti-mouse Cyanine 3 (115-167-003, Jackson ImmunoResearch), anti-rabbit Cyanine 3 (111-166-045, Jackson ImmunoResearch), anti-mouse DyLight® 649 (715–495-150, Jackson ImmunoResearch), anti-rabbit Cyanine 5 (111-175-144, Jackson ImmunoResearch), anti-digoxigenin TAMRA (11207750910, Roche) (used for FISH).
Primary and secondary antibodies were usually diluted at 1:200.
Centromere-specific oligonucleotide probes were used for the FISH experiments: the a7d probe (5′ AT TG TC CT CA AA TC GC TT 3′) targets the D7Z1 α-satellite repeats while the a11G probe (5′ AG GG TT TC AG AG CT GC TC 3′) targets the D11Z1 repeats (nucleotides underlined indicate LNA bases). The a7d oligonucleotide is coupled with digoxigenin and a11G with AF488 fluorophore. The D7Z1 probe used for IF-FISH was generated by random priming, the PCR product used for the reaction was obtained by amplifying U2OS DNA with the following primers: Fwd 5′ ACGGGGTTTCTTCCTTTCAT/Rev 5′ GCTCTCTCTAAAGCAAGGTTCA.
Primary and secondary antibodies were usually diluted at 1:200.
Centromere-specific oligonucleotide probes were used for the FISH experiments: the a7d probe (5′ A
5
Immunostaining Striatal Neuron Subtypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify direct- and indirect-pathway SPNs electrodes were loaded with biocytin, as described (Martella et al., 2009 (link)). Briefly, slices were fixed with 4% PFA in 0.12 M PB and 30 μm thick sections were cut from each slice with a freezing microtome, then dehydrated with serial alcohol dilutions to improve antigen retrieval and reduce background (Buchwalow et al., 2011 (link)). We used the following primary antibodies: goat anti-DARPP-32 (1:500 AF6259, R and D system), mouse anti-Enkephalin (1:1000 MAB350, Millipore), and secondary antibodies: anti-goat alexa 647 (Invitrogen), anti-mouse cyanine 3 (Jackson ImmunoResearch) and streptavidin-conjugated alexa 488 (Life Technologies). All sections used for analysis were processed together. Images were acquired with a LSM700 Zeiss confocal laser scanning microscope and analyzed with ImageJ software (NIH; Schneider et al., 2012 (link)). Noise was reduced by applying background subtraction in ImageJ.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!