Klenow fragment exo

RNA primers were removed from SNS molecules with RNAse A/T1 Mix (Roche) for 60 min at 37°C. 100 μg/ml Proteinase K was added (30 min, 37°C) and DNA was extracted and precipitated. ssDNA was converted to dsDNA using 50 pmol of random hexamer primers phosphate (Roche) as described (39 (link)). Primer extension was performed by incubation with 10 mM dNTPs (Roche) and 5 U exo- Klenow Fragment (New England Biolabs) for 1 h at 37 C followed by incubation with 80 U of TaqDNA ligase (New England Biolabs; 50 C/30 min). DNA was extracted, precipitated and resuspended in TE. For the input sample, 4 × 10⁷ mESCs were lysed in 1% SDS, 50 mM Tris–HCl pH 8.0, 10 mM EDTA (2 × 10⁷ cell/ml) and sonicated in a Bioruptor device (Diagenode) for 25 min at 30 s intervals. DNA was extracted with phenol/chloroform, ethanol-precipitated and resuspended in 0.5× TE. DNA libraries were prepared at the Fundación Parque Científico de Madrid (FPCM) using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs) and purified with Agencourt AMPure XP beads (Beckman Coulter). Each library was sequenced using single-end 75 bp reads (120–140 × 10⁶ reads per sample) in a NextSeq500 System (Illumina).

All possible 65,536 8-base-pair (bp) DNA sequences were assembled into a maximally compact de Bruijn sequence that was subsequently divided over 1457 oligonucleotides. Each 70-bp-long oligonucleotide contained 45 overlapping 8-mers, a 3-bp GC clamp at the 5′ end, and an identical 14-bp sequence at the 3′ end for Cy5 labeling and primer extension (Fordyce et al. 2010 (link)). Sequences were hybridized to a Cy5-labeled oligonucleotide and extended using a Klenow fragment (exo⁻) (New England Biolabs) to produce Cy5-labeled dsDNA (Fordyce et al. 2010 (link)). Cy5-labeled dsDNA was diluted to a final concentration of 1.25 μM. Each sample solution contained 0.125% of poly(ethylene glycol) (Aldrich) and D-trehalose dehydrate (Sigma) at 12.5 mg/mL in dH₂O to prevent irreversible binding of the DNA to the glass as well as for visualization during alignment of the device to the DNA array. The oligos were spotted onto epoxy-coated glass substrates (CEL Associates) with a MicroGrid 610 (Bio Robotics) microarrayer using SMT-S75 silicone pins (Parallel Synthesis). Column and row pitch corresponded to the specific device. The device that we used contained 65 columns and 64 rows with a pitch of 281.25 µm by 562.5 µm, respectively. Finally, the arrays were aligned to the microfluidic device by hand under a stereoscope and bonded overnight on a heated plate at 80°C.

A solution (20 μl) of (CTG)₂₀ ODN10 (5.0 μM) and VDAT–acridine conjugate 2 (100 μM) in MES buffer (50 mM, pH 7.0) containing NaCl (100 mM) and 2% DMSO was incubated at 37°C for 6 or 24 h. The mixture was used as the alkylated template ODN10. A solution (30 μl) of the primer ODN9 (0.17 μM), the alkylated template ODN10 (0.5 μM) and internal standard ODN2 (Y = dT) (0.07 μM) in NE buffer 2 (50 mM NaCl, 10 mM Tris–HCl, 10 mM MgCl₂, 1 mM DTT, pH 7.9, New England Biolabs) was heated at 93°C and gradually cooled to room temperature for the annealing. To the solution were added dNTP (2.4 μl, final 0.2 mM) and the Klenow Fragment (exo−) (0.6 μl, final 0.1 U/μl, New England Biolabs), then the mixture was incubated at 37°C for 10 min. The reaction mixture was quenched by a loading buffer (80% formamide, 10 mM EDTA, 30 μl), then cooled to 0°C. Electrophoresis was performed on a 14% denaturing polyacrylamide gel containing 30% formamide with 1 × TBE and 5.3 M urea at 300 V and 40°C for 25 min.

Library preparation was done similar to Blecher-Gonen et al. (41 (link)) with some changes. Briefly, Sonicated DNA was subjected to a 50 μl end repair reaction using 1 μl End repair mix (E6050L, NEB), cleaned by 1.8× Ampure XP beads, followed by a 50μl A-tail reaction using 2 μl Klenow fragment exo- (M0212L, NEB). The products were cleaned by 1.8× beads and were ligated by 2 μl quick ligase (M2200, NEB) to 0.75 μM illumina compatible forked indexed adapters. Ligation products were size selected by 0.7× PEG (considering the PEG in the ligation buffer) in order to remove free adaptors. 12–19 cycles of amplification were performed by PFU Ultra II Fusion DNA polymerase (600670, Agilent) with the following Primers:

P7 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC 3′,

P5 5′ CAAGCAGAAGACGGCATACGAGAT 3′.

Amplified DNA was size selected for 300–700 bp fragments by taking the supernatant after using 0.5× beads (which removed fragments greater than 700 bp) followed by a 1.0× beads cleaning (which removed remaining primers and adapter dimers). The final quality of the library was assessed by Qubit and TapeStation. Libraries were pooled and sequenced on NextSeq (illumina) for 75 bp paired-end sequencing, generating 10M reads per each library.