Total RNA was extracted from 5 × 106 lymphocytes using RNeasy (74104; Qiagen, Venlo, Netherlands). The genomic facility at Instituto de Investigaciones Biomedicas synthesized complementary DNA using M-MLV retro transcriptase (ThermoFischer Scientific) and analyzed gene expression by real-time quantitative (RT-qPCR) as described (23 (link)) using TaqMan Gene Expression Assays (ThermoFischer Scientific) specific for human MAZ (Hs00911157_g1), MYB (Hs00193527_m1), CYCNG2 (Hs00171119_m1), E2F1 (Hs00153451_m1) and GUSB (Hs99999908_m1). GUSB was chosen as a control gene on the basis of its homogeneous expression in stimulated and untreated lymphocytes. Each gene expression experiment was performed at least three times and calculations were made from measurements of three replicates of each sample.
M mlv retro transcriptase
Manufactured by Thermo Fisher Scientific
Sourced in United States
M-MLV retro transcriptase is an enzyme used in the reverse transcription process, which converts single-stranded RNA into complementary DNA (cDNA). This enzyme plays a crucial role in various molecular biology applications, such as gene expression analysis and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Hotstart taq polymerase, by Qiagen (2 mentions)
Bigdye 3.1 sequencing kit, by Thermo Fisher Scientific (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Random primer, by Thermo Fisher Scientific (1 mentions)
Iqtm sybr green supermix reagent, by Bio-Rad (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Maxwell 16 lev simplyrna cells kit, by Promega (1 mentions)
T4 pnk enzyme, by New England Biolabs (1 mentions)
Pcr2.1 plasmid vector, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Actinomycin d, by Merck Group (1 mentions)
Nucleospin rna kit, by Macherey-Nagel (1 mentions)
Universal master mix, by Thermo Fisher Scientific (1 mentions)
6 protocols using m mlv retro transcriptase
1
RNA Extraction and Gene Expression Analysis
2
Detection of MET and EML4-ALK mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was retrotranscribed with the M-MLV retrotranscriptase (ThermoFisher Scientific, Waltham, MA, USA) and random primers. HotStart Taq polymerase (Qiagen) was used for METΔex14 and EML4-ALK amplification using a 20 µL reaction (45 cycles) and visualized in agarose gels, as described [9 (link),11 (link)]. Positive samples were confirmed by bidirectional Sanger sequencing of RT-PCR products, using the big-dye 3.1 sequencing kit (Applied Biosystems, Foster City, CA, USA).
3
Detection of METΔex14 Splice Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was converted to cDNA using M‐MLV retrotranscriptase (Thermo Fisher Scientific) and oligo‐dT primers, and METΔex14 was amplified using HotStart Taq polymerase (Qiagen) in a 20 µL reaction and visualized in agarose gels. Primers used were located in exons 13 and 15, sequences were as follows: forward (exon 13) 5′‐TTTTCCTGTGGCTGAAAAAGA‐3′ and reverse (exon 15) 5′‐GGGGACATGTCTGTCAGAGG‐3′. Amplification generated a 246‐bp band for wild‐type (wt) MET RNA and a 106‐bp band for METΔex14. Positive samples were confirmed by bidirectional Sanger sequencing of RT–PCR products, using the big‐dye 3.1 sequencing kit (Applied Biosystems, Waltham, MA, USA).
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from frozen liver samples using the Maxwell 16 LEV simplyRNA Cells Kit (Promega) following the manufacturer’s recommendations. Two micrograms of RNA, treated with DNase I, was retro-transcribed using Moloney Murine Leukemia Virus (M-MLV) retro-transcriptase (Invitrogen) and random primers (Life Technologies, Thermo). cDNA was amplified, and relative gene expression was determined by qPCR using iQTM SYBR Green Supermix reagent (Bio-Rad) in CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Table 1 contains the sequence of primers specific for the transgene (CYP27A1) and the mouse genes Cyp7a1, Cyp3a11, Cyp27a1 (exons 1/2), Cyp27a1 (exons 8/9), and 36b4 (used as a housekeeping gene).
Delta cycle threshold (ΔCt) values using 36b4 mRNA levels as reference gene were corrected with the efficiency of amplification of each pair of primers and multiplied by 1,000 to facilitate graphical representation.
Delta cycle threshold (ΔCt) values using 36b4 mRNA levels as reference gene were corrected with the efficiency of amplification of each pair of primers and multiplied by 1,000 to facilitate graphical representation.
5
Circular RNA Detection in E. histolytica
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All primers and PCR conditions are listed in Table S1 . RabX13 (EHI_065790), U6 snRNA (U43841), 18S rRNA (AB426549), RNA Pol II (EHI_087360), and EhActin (EHI_107290) gene expression were monitored by RT-PCR using specific primer pairs, M-MLV retro transcriptase, and Taq DNA Polymerase, as specified by the manufacturer (Invitrogen). All PCR products were cloned into the pCR2.1 plasmid vector (Invitrogen) and sequenced.
To detect circular RNA molecules, specific outward facing primer pairs targeted to the introns of the E. histolytica genes RabX13, rpL12 (EHI_191750), rpS14 (EHI_074090), Cdc2 (L03810), and intron 2 of ClcB (EHI_186860), respectively, were designed as described (Vogel et al., 1997 (link)). The primers were used in circular RT-PCR using the aforementioned conditions. In some cases, PCR reactions were carried out with the 5′-end radiolabeled Rab2BSs oligonucleotide. Radiolabeling was carried out with the T4 PNK enzyme (New England BioLabs) as suggested by the manufacturer. Where indicated, RT reactions were carried out in the presence of 5 μM Actinomycin D (Sigma-Aldrich), adding the drug immediately after the denaturing step (Houseley and Tollervey, 2010 (link)). PCR products were resolved in 8% urea-polyacrylamide gels. The Kappa Syber Fast Universal One-Step qRT-PCR kit (Sigma Aldrich) was used for quantitative RT-PCR with 10 ng of cDNA input in 10 μL.
To detect circular RNA molecules, specific outward facing primer pairs targeted to the introns of the E. histolytica genes RabX13, rpL12 (EHI_191750), rpS14 (EHI_074090), Cdc2 (L03810), and intron 2 of ClcB (EHI_186860), respectively, were designed as described (Vogel et al., 1997 (link)). The primers were used in circular RT-PCR using the aforementioned conditions. In some cases, PCR reactions were carried out with the 5′-end radiolabeled Rab2BSs oligonucleotide. Radiolabeling was carried out with the T4 PNK enzyme (New England BioLabs) as suggested by the manufacturer. Where indicated, RT reactions were carried out in the presence of 5 μM Actinomycin D (Sigma-Aldrich), adding the drug immediately after the denaturing step (Houseley and Tollervey, 2010 (link)). PCR products were resolved in 8% urea-polyacrylamide gels. The Kappa Syber Fast Universal One-Step qRT-PCR kit (Sigma Aldrich) was used for quantitative RT-PCR with 10 ng of cDNA input in 10 μL.
6
Chondrogenic Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the chondrogenesis experiments (Sections 2.10 and 2.11) after three weeks of culture using a NucleoSpin ® RNA kit (Macherey-Nagel) following the manufacturer's protocol. Total RNA (500 ng) was then converted to cDNA with MML-V retrotranscriptase (Invitrogen). All real-time quantitative polymerase chain reactions (PCR) were performed on a Taqman RealPlex System (Eppendorf) in 20 µl reaction volume containing 1x Universal Master Mix (Applied Biosystems), 1x Taqman Assay, cDNA and RNAse free water. The expression of the following genes was examined: Sox9 and Aggrecan. Actin B and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as housekeeping genes. The primer sequences for all genes are listed in the Supplementary Material (Table S1). The PCR reaction was performed for 1 min at 95 ºC, followed by 40 amplification cycles (15 s at 95 ºC, 15 s at 60 ºC, and 20 s at 72 ºC). Each PCR was processed in triplicate. Relative transcript levels were calculated using the 2-delta delta ct (cycle-threshold) method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!