Veriquest sybr green qpcr master mix

Manufactured by Thermo Fisher Scientific

Sourced in United States

The VeriQuest SYBR Green qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains SYBR Green I dye, a DNA-binding fluorescent dye, which allows for the detection and quantification of double-stranded DNA during the PCR reaction.

Automatically generated - may contain errors

Lab products found in correlation

45 protocols using veriquest sybr green qpcr master mix

Marigold Extract Effects on Pancreatic Cancer

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

MiaPaca-2 and Panc-1 cells (0.35 × 10⁶ cells) were treated with marigold SFE for 48 h at different doses: ½ IC₅₀, 1 × IC₅₀, 2 × IC₅₀, with IC₅₀ values being equal to 39.8 μg/ml (±_4.6) and 43.2 μg/ml (±7.9), respectively, for MiaPaca-2 and Panc-1, as previously described (Mouhid et al., 2018 (link)). Non-treated cells were kept as controls.
Total RNA was extracted with Tri Reagent (Sigma). One microgram of RNA was reverse-transcribed with the High Capacity RNA-to-cDNA Master Mix system (Life Technologies). Quantitative polymerase chain reaction (qPCR) was performed in the 7900HT Real-Time PCR System (Life Technologies) using the VeriQuest SYBR Green qPCR Master Mix (Affymetrix, Santa Clara, CA, USA), and Taqman probes were used: Hs01629120_s1, Hs01029413_m1, Hs00245183_m1, and Hs99999901_s1 for BMP8B, TFAP2A, ZFP36L1, and 18S, respectively; or oligos in the case of the epithelial-to-mesenchymal transition (EMT), stemness and endoplasmic reticulum (ER) stress markers (Table S1 displays the list and sequences of the primers used). The 2^−ΔΔCt method was applied to calculate the relative gene expression (Livak and Schmittgen, 2001 (link)).

Gómez de Cedrón M., Mouhid L., García-Carrascosa E., Fornari T., Reglero G, & Ramírez de Molina A. (2020). Marigold Supercritical Extract as Potential Co-adjuvant in Pancreatic Cancer: The Energetic Catastrophe Induced via BMP8B Ends Up With Autophagy-Induced Cell Death. Frontiers in Bioengineering and Biotechnology, 7, 455.

+ Open protocol

+ Expand

Quantification of EMT-related Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cell lines or flash-frozen tissue as described above was reverse-transcribed using iScript (Bio-Rad). Real-Time PCR was conducted using VeriQuest SYBR Green qPCR Master Mix (Affymetrix). Peptidylprolyl isomerase B (Ppib) was used for normalization of expression levels. Expression of mRNA was defined from the threshold cycle, and relative expression levels were calculated using delta delta Ct after normalization with Ppib.
Primers sequences 5’−3’:
Cdh1 F: AAGTGACCGATGATGATGCC, R: GCGACTCTACCTGTCTCTTC
Epcam F: AACACAAGACGACGTGGACA, R: GCTCTCCGTTCACTCTCAGG
Snai1 F: GTGTGTGGAGTTCACCTTC, R: GGAGAGAGTCCCAGATGAG
Twist1 F: TTCTCCGTCTGGAGGATG, R: TCCTTCTCTGGAAACAATGAC
Ppib F: GGAGATGGCACAGGAGGAAAGAG, R: TGTGAGCCATTGGTGTCTTTGC
Vim F: CTGTACGAGGAGGAGATGCG, R: AATTTCTTCCTGCAAGGATT

Ross C., Szczepanek K., lee M., Yang H., Peer C.J., Kindrick J., Shankarappa P., Lin Z.W., Sanford J., Figg W.D, & Hunter K. (2020). Metastasis-specific gene expression in autochthonous and allograft mouse mammary tumor models: stratification and identification of targetable signatures.. Molecular cancer research : MCR, 18(9), 1278-1289.

+ Open protocol

+ Expand

Quantifying R. typhi Gene Expression in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells (~1 × 10⁶ cells) were infected with R. typhi at a multiplicity of infection (MOI) of ~100 and incubated at 34°C with 5% CO₂ for 10 min, 30 min, 2 h, and 24 h. At each time point, cells were washed with phosphate-buffered saline (pH 7.4) and RNA was extracted using a Quick-RNA miniprep kit (Zymo Research). IScript reverse transcription supermix for RT-qPCR (Bio-Rad) was used to synthesize cDNA from 500 ng of purified RNA. qPCR was performed with VeriQuest SYBR green qPCR master mix (Affymetrix) in a CFX384 Multicycler (Bio-Rad) (for primer sequences, see Text S6 in the supplemental material). The thermal cycling conditions included 95°C for 3 min followed by 40 cycles of amplification at 95°C for 10 s and 55°C for 60 s. A melting curve analysis was performed to confirm amplification of a single product for each primer pair. A panel of 6 reference genes (see Text S6 in the supplemental material) was tested to determine which genes were stably expressed (geNorm M score ≤ 0.5; Qbase Plus; Biogazelle) with infection. rvhB8-I and rvhB8-II gene expression was normalized to the average cycle threshold (C_T) of R. typhi reference genes adr1 and sca5 (2^ΔCT).

Gillespie J.J., Phan I.Q., Scheib H., Subramanian S., Edwards T.E., Lehman S.S., Piitulainen H., Sayeedur Rahman M., Rennoll-Bankert K.E., Staker B.L., Taira S., Stacy R., Myler P.J., Azad A.F, & Pulliainen A.T. (2015). Structural Insight into How Bacteria Prevent Interference between Multiple Divergent Type IV Secretion Systems. mBio, 6(6), e01867-15.

+ Open protocol

+ Expand

Quantifying AhR and Cyp1A1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cell pellets collected from ex-vivo experiments following stimulation with LPS, LPS+L-Kyn, LPS+L-Kyn+AhRA, and LPS+AhRA using Pure-Link™ RNA Mini Kit (cat# 12183018A, Invitrogen, USA) and by following manufacturer’s recommendations. cDNA was made using Prime script 1^st strand cDNA synthesis kit (cat# 6110A, TaKaRa Biotechnology, USA). Reverse transcription was conducted with Veri Quest SYBR Green qPCR master mix (Affymetrix, USA). The primer sequences used were as follows: AhR (forward-AGGCCAGGACCAGTGTAGAG, reverse-CTTGGATAGTGGAGGAAGCA), Cyp1A1 (forward-TGGATGCCTTCAAGGACTTG, reverse- CAGCTTCCTGTCCTGACAAT) and RPS-18 was selected as reference or housekeeping genes (forward-GAACTCACGGAGGATGAGGT, reverse-TCTAGACCGTTGGCCAGAAC).

Tousif S., Wang Y., Jackson J., Hough K.P., Strenkowski J.G., Athar M., Thannickal V.J., McCusker R.H., Ponnazhagan S, & Deshane J.S. (2021). Indoleamine 2, 3-Dioxygenase Promotes Aryl Hydrocarbon Receptor-Dependent Differentiation Of Regulatory B Cells in Lung Cancer. Frontiers in Immunology, 12, 747780.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and purified using Aurum total RNA mini kit (Bio-Rad). After NanoDrop RNA quantification (Thermo Scientific), reverse transcription was done with the GoScript Reverse cDNA Synthesis kit (Promega). Quantitative PCR (qPCR) reactions were performed in a final volume of 10 μl using VeriQuest SYBR Green qPCR Master Mix (Affymetrix) with the PikoReal Real-Time PCR System (Thermo Scientific): preincubation at 95°C for 7 min, 40 cycles at 95°C for 15 s, 60°C for 60 s followed by melting curves. Primers are listed in Supplementary Table 3. Levels of CYCLIN-DEPENDENT KINASE A-1 (CDKA-1) and UBIQUITIN 10 (UBQ10) were used as normalization factors. Data present the transcript levels of three pooled organs, each sample being assessed by three technical replicates.

De Caluwé J., Xiao Q., Hermans C., Verbruggen N., Leloup J.C, & Gonze D. (2016). A Compact Model for the Complex Plant Circadian Clock. Frontiers in Plant Science, 7, 74.

+ Open protocol

+ Expand

Relative mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Determination of relative mRNA expression was conducted in duplicate on a QuantStudio 5 Real‐Time PCR system (Thermo Fisher Scientific) using 10 ng of template cDNA and VeriQuest SYBR Green qPCR Master Mix (Affymetrix, Santa Clara, CA). The rat β‐Actin gene was used as an internal standard for normalization, and relative changes in mRNA abundance were calculated using the comparative ΔΔCt method (Livak and Schmittgen 2001). Briefly, the threshold cycle (Ct) for β‐Actin was subtracted from the Ct for the gene of interest to determine the ΔCt value. Fold‐induction of target genes in RYGB animals was calculated by subtraction of RYGB ΔCt from the average Sham ΔCt, and expressed as an exponential of the negative value.

Sacks J., Mulya A., Fealy C.E., Huang H., Mosinski J.D., Pagadala M.R., Shimizu H., Batayyah E., Schauer P.R., Brethauer S.A, & Kirwan J.P. (2018). Effect of Roux‐en‐Y gastric bypass on liver mitochondrial dynamics in a rat model of obesity. Physiological Reports, 6(4), e13600.

+ Open protocol

+ Expand

Evaluating Stemness and EMT Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies recognizing CD44, snail, slug, vimentin, and P-gp were purchased from Cell Signaling technologies (Danvers, MA, USA), E-cadherin was purchased from Abcam (Cambridge, MA, USA), EXT1, β-actin was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), and HS was purchased from Amsbio (Abingdon, UK). Doxo and DAPI were purchased from Sigma-Aldrich (Saint Louis, MO, USA). Methylthiazoletetrazolium solution (MTT) was obtained from AMRESCO (Solon, OH, USA). M-MLV Reverse Transcriptase was purchased from Promega (Madison, WI, USA) and VeriQuest SYBR Green qPCR Master Mix was obtained from Affymetrix (Cleveland, OH, USA). Pro-PREP protein extraction solution was purchased from iNtRON Biotechnology (Seongnam, Korea). Fluorochrome-conjugated monoclonal antibodies against human CD44 (FITC; cat. #555478) and CD24 (PE; cat. #555428) or the respective isotype controls were purchased from BD Biosciences (San Diego, CA, USA). ALDEFLUOR™ kit was obtained from STEMCELL Technologies (Vancouver, Canada). Predesigned siRNA targeting EXT1 (siEXT1) and negative siRNA (siNC) were from BIONEER Co (Daejeon, South Korea).

Manandhar S., Kim C.G., Lee S.H., Kang S.H., Basnet N, & Lee Y.M. (2017). Exostosin 1 regulates cancer cell stemness in doxorubicin-resistant breast cancer cells. Oncotarget, 8(41), 70521-70537.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using TRIzol reagent following the manufacturer’s protocol (Thermo). The RNA concentration was quantified by spectrophotometer (Nanodrop; Thermo) and complementary DNA (cDNA) was synthesized using QuantiTech Reverse Transcription kit (Qiagen, Valencia CA). qRT-PCR was performed using VeriQuest SYBR Green qPCR master mix (Affymetrix, Santa Clara CA) on a StepOnePlus thermocycler (Applied Biosystems, NY). Primers were designed using qPrimerDepot software (http://mouseprimerdepot.nci.nih.gov/) for mouse and synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) with sequences described in Table S1. The results are normalized to 18S and expressed as fold change based on the ΔΔ^CT method +/− SD of 3 replicates.

Ha S.W., Park J., Habib M.M, & Beck GR J.r. (2017). Nano-Hydroxyapatite Stimulation of Gene Expression Requires Fgf Receptor, Phosphate Transporter, and Erk1/2 Signaling. ACS applied materials & interfaces, 9(45), 39185-39196.

+ Open protocol

+ Expand

Tumor and Cell Line RNA Isolation and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from tumors and cell lines using RNeasy kit (Qiagen) or TriPure (Roche) and reverse transcribed using iScript (Bio-Rad). Real-Time PCR was conducted using VeriQuest SYBR Green qPCR Master Mix (Affymetrix).

Faraji F., Hu Y., Yang H.H., Lee M.P., Winkler G.S., Hafner M, & Hunter K.W. (2016). Post-transcriptional Control of Tumor Cell Autonomous Metastatic Potential by CCR4-NOT Deadenylase CNOT7. PLoS Genetics, 12(1), e1005820.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using TRIzol reagent (Invitrogen) and cDNA synthesized using QuantiTech Reverse Transcription kit (Qiagen, Valencia CA). qRT-PCR was performed using VeriQuest SYBR Green qPCR master mix (Affymetrix, Santa Clara CA) on a StepOnePlus thermocycler (Applied Biosystems, NY). Primers were designed using qPrimerDepot software (http://primerdepot.nci.nih.gov) and synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) with sequences as follows; 18S (control): F-5’-CAGCCACCCGAGATTGAGCA-3’, R-5’-TAGTAGCGACGGGCGGCGTG-3’. ALP: F-5’-CTATCCTGGCTCCGTGCTC-3’, R-5’-GCTGGCAGTGGTCAGATGTT-3’. OSC: F-5’-TGAGAGCCCTCACACTCCTC-3’, R-5’-CCTCCTGCTTGGACACAAAG-3’. Runx2: F-5’-CAGTAGATGGACCTCGGGAA-3’, R-5’-CCTAAATCACTGAGGCGGTC-3’. Fold change was calculated using the 2^−ΔΔCT method.^{23 (link)}

Weitzmann M.N., Ha S.W., Vikulina T., Roser-Page S., Lee J.K, & Beck GR J.r. (2015). Bioactive Silica Nanoparticles Reverse Age-Associated Bone Loss in Mice. Nanomedicine : nanotechnology, biology, and medicine, 11(4), 959-967.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!