Ovation ultralow v2 dna seq library preparation kit

Library preparation and sequencing were performed as previously described (51 (link)) by the microarray and genomics core at the University of Colorado Anschutz Medical Campus. Briefly, genomic DNA was sheared to approximately 340-bp fragments and processed through the Ovation Ultralow V2 DNA-Seq library preparation kit (Tecan); 9 ng of each library was used as the template to enrich by PCR (16 cycles) for the transposon insertions using Krmit-specific (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCATCCAACC) and Illumina P7 primers. The enriched PCR products were diluted 1:100, and 20 μl was used as the template for an indexing PCR (9 cycles) using the TruSeq P5 indexing and P7 primers. Sequencing was performed using an Illumina NovaSeq 6000 in a 150-base paired-end format.

Library preparation and sequencing were performed as previously described (68 (link)) by the Microarray and Genomics Core at the University of Colorado Anschutz Medical Campus. Briefly, genomic DNA was sheared to approximately 340-bp fragments and processed through the Ovation ultralow V2 DNA-Seq library preparation kit (Tecan), and 9 ng of each library was used as a template for enrichment by PCR (16 cycles) for the transposon insertions using Krmit-specific (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCATCCAACC) and Illumina P7 primers. The enriched PCR products were diluted 1:100, and 20 μL was used as a template for an indexing PCR (9 cycles) using the TruSeq P5 indexing and P7 primers. Sequencing was performed to obtain roughly 20 million reads per sample using an Illumina NovaSeq 6000 system in a 150-base paired-end format.

ChIP DNA was quality-controlled using the next-generation sequencing assay on a FEMTO pulse (Agilent Technologies). An Illumina-compatible library was prepared with the Ovation Ultralow V2 DNA-Seq library preparation kit (Tecan Genomics) and sequenced as single-end 150 bp reads on a NextSeq2000 (Illumina) instrument. An average of 20 million reads were obtained for each library.
Raw sequencing reads were trimmed using Cutadapt^{93 (link)} to remove low-quality nucleotides (with a quality score <30) and the adaptors. Trimmed ChIPed 150 bp single-end reads were mapped to their respective reference genome using bowtie2 (ref. ^{85 (link)}) with default parameters. All read duplicates were removed and only the single best-matching read was kept on the final alignment Binary Alignment Map (BAM) file. The BAM files were converted to BIGWIG coverage tracks using the bamCompare tool from deeptools^{94 (link)}. Coverage was calculated as the number of reads per 50 bp bin and normalized as reads per kilobase per million mapped reads (RPKM). Magnified chromosome regions showing multiple tracks presented in Fig. 4g were plotted with pyGenomeTracks^{95 (link)}.

Genomic DNA was extracted with the cetyltrimethylammonium bromide method (Murry & Thompson, 1980 (link)). DNA sequencing libraries were prepared starting from 100 ng of isolated DNA using the Ovation Ultralow V2 DNA‐Seq Library Preparation kit (Tecan, Männedorf, Switzerland), normalized to 10 nm, multiplexed, and clustered on HiSeq 3000/4000 PE flow cells using HiSeq 3000/4000 PE Cluster kits (Illumina, San Diego, CA, USA). Sequencing was performed on an Illumina HiSeq 4000 system using an Illumina HiSeq 3000/4000 SBS kit (300 cycles).
Raw reads were mapped to a chromosome‐anchored tobacco K326 reference genome (registration in progress) using Minimap2 (v2.16‐r922), and duplicates were removed using samblaster (v0.1.24). samtools (v1.9) was used to sort the read alignments and store them in BAM format, while bedtools (v2.28.0) was used to determine genome coverage.
Polymorphisms around the NIC1 locus were detected by analyzing mapped sequencing reads from Burley 21 (wild type), LI Burley 21 (nic1‐1), and LA Burley 21 (nic1‐1 nic2‐1) using bcftools (v1.9), filtering out variants with a call quality <30 or a read depth <20. The obtained variants were further filtered to retain only those that were also detected when comparing NC95 (the wild type) and LAFC53 (nic1‐1 nic2‐1).