Bulge loop mirna rt qpcr primer set

Total RNA was extracted from the transfected and infected THP-1 and RAW 264.7 cells using TRIzol^® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Total RNA (1 µg) was reverse transcribed into cDNA using the M-MLV First Strand Kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. qPCR was subsequently performed using the SYBR-Green PCR master mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) in a 7900HT Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was conducted under the following conditions: Initial denaturation at 95°C for 20 sec, followed by 40 cycles of 95°C for 5 sec, 60°C for 30 sec and 72°C for 15 sec. The primers used for qPCR are provided in Table II. For IL-6, TNF-α and IL-1β, β-actin was used as the internal reference gene. Bulge-loop™ miRNA RT-qPCR primer sets specific for miR-502-3p were designed by Guangzhou RiboBio Co., Ltd. For miR-502-3p, U6 was used as the internal control. Relative expression levels were analyzed using the 2^−ΔΔCq method (16 (link)).

Total RNA, miRNA included, was extracted from tissues and cells by TRIzol reagent (Thermo Fisher Scientific, Inc.) in accordance with manufacturer's protocol and cDNA was produced by means of PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd.). The RT kit was used according to the manufacturer's protocol. The RT-qPCR experiment was conducted through a 10 µl reaction system which consists of 1 µl cDNA, 1 µl primers, 4 µl dH₂O and 4 µl SYBR via SYBR-Green PCR kit (Roche Diagnostics). StepOne Plus Real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used to performed final reaction. Thermocycling conditions was set as follows: Initial denaturation at 95°C for 3 min, followed by 35 cycles at 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec, followed by 72°C for 10 min. The method used to standardize the RT-qPCR data was the 2^−ΔΔCq method which facilitates the analysis of relative changes in gene expression in real-time quantitative PCR experiments (8 (link)). U6 was used as the internal controls for miRNA quantification while β-actin was used for mRNA. The primers used were: DNAJC2 forward, GTTGCGTTGTCTGCTTGAGGT; DNAJC2 reverse, CTGTGAATCTGTTCCCTGCTG; β-actin forward, AGCGAGCATCCCCCAAAGTT; β-actin reverse, GGGCACGAAGGCTCATCATT. Bulge-loop miRNA RT-qPCR Primer Sets specific for miR-672-3p were designed by Guangzhou RiboBio Co., Ltd.

The level of miR-186-5p in AC16 cells, following treatment as described above, was detected with RT-qPCR. Total RNA was extracted from AC16 cells using an miRcute miRNA Isolation kit according to manufacturer's protocol. Single-strand cDNA was synthesized using an miRcute miRNA First-strand cDNA Synthesis kit according to manufacturer's protocol. qPCR was performed via a one step method with an miRcute miRNA qPCR Detection kit according to the manufacturer's protocol. U6 small nuclear RNA was used as an internal reference. Bulge-loop miRNA RT-qPCR Primer Sets (one RT primer and a pair of qPCR primers for each set) specific for miR-186-5p were designed by RiboBio (Guangzhou, China). Primer sequence of miR-186-5p was as follows: forward, 5′-TCAAAGAATTCTCCTTTTGGGCT-3′ and reverse 5′-CGCTTCACGAATTTGCGTGTCAT-3′. PCR was performed for 2 min at 94°C, followed by 40–45 cycles of 94°C for 20 sec and 60°C for 34 sec. The amplified products were measured using 1% agarose gel electrophoresis and densitometry of bands was analyzed using Image J software bundled with Java 1.8.0–112 (National Institutes of Health, Bethesda, MD, USA). Relative quantitative values were calculated using the 2^−ΔΔCq method (16 (link)).