Whole‐cell extracts (WCEs) were prepared, and western analysis was performed as described [9 (link), 40 (link)]. The primary antibodies were the following: JAK1 (Proteintech, Rosemont, IL, USA, #66466‐I‐Ig; dilution 1 : 500), Bcl3 (Proteintech, #23959‐I‐AP; dilution 1 : 500), STAT1 (Cell Signaling, Danvers, MA, USA, #9172; dilution 1 : 1000), Ser727 p‐STAT1 (Cell Signaling, #8826; dilution 1 : 1000), p65 NFκB (Santa Cruz, #sc‐8008; dilution 1 : 200), K314/315 ac‐p65 (Signalway Antibody, Greenbelt, MD, USA, HW136; dilution 1 : 200), histone H3 (Abcam, Cambridge, MA, USA, Ab1791; dilution 1 : 1000), Lys9 acetyl histone H3 (Cell Signaling, #9649S; dilution 1 : 1000), and control actin (Sigma, St. Louis, MO, USA, A5060; dilution 1 : 2000).
Acetyl histone h3 lys9
Manufactured by Cell Signaling Technology
Sourced in United States
Acetyl-histone H3 (Lys9) is a lab equipment product that detects the acetylation of histone H3 at lysine 9. Acetylation of histones is a key epigenetic modification that regulates gene expression.
Automatically generated - may contain errors
Lab products found in correlation
Histone h3, by Cell Signaling Technology (5 mentions)
Histone h3, by Abcam (4 mentions)
Hdac6, by Cell Signaling Technology (3 mentions)
Tubastatin a, by Selleck Chemicals (3 mentions)
Acetyl α tubulin lys40, by Cell Signaling Technology (3 mentions)
Ser727 p stat1, by Cell Signaling Technology (2 mentions)
Stat1, by Cell Signaling Technology (2 mentions)
P stat3, by Cell Signaling Technology (2 mentions)
α tubulin, by Cell Signaling Technology (2 mentions)
E cadherin, by Cell Signaling Technology (2 mentions)
Smad3, by Cell Signaling Technology (2 mentions)
P smad3, by Cell Signaling Technology (2 mentions)
Snail, by Cell Signaling Technology (2 mentions)
Cleaved caspase 3, by Cell Signaling Technology (2 mentions)
β actin, by Merck Group (2 mentions)
Acetyl histone h4 lys8, by Cell Signaling Technology (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Histone h3 antibody, by Cell Signaling Technology (2 mentions)
Acetyl histone h3 lys18, by Cell Signaling Technology (2 mentions)
Acetyl histone h3 lys27, by Cell Signaling Technology (2 mentions)
19 protocols using acetyl histone h3 lys9
1
Whole-cell Western Blot Analysis
2
ChIP Assay of Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was performed as described [40 (link), 41 (link)], using the following antibodies: STAT1 (Cell Signaling, #9172), Ser727 p‐STAT1 (Cell Signaling, #8826S), histone H3 (Abcam, Ab1791), Lys9 acetyl histone H3 (Cell Signaling, #9649S), p65 (Sigma, MAB3026), and K314/315 ac‐p65 (Signalway, HW136). Each immunoprecipitation was performed at least three times using different chromatin samples, and the occupancy was calculated by using human IGX1A negative control primers (SA Biosciences, Frederick, MD, USA). The results were calculated as a fold difference in STAT1, Ser727 p‐STAT1, histone H3, ac‐H3, p65, and K314/315 ac‐p65 occupancy at human Bcl3 promoter compared with the control negative IGX1A locus that does not bind any transcription factors. The Bcl3 primers used for real‐time PCR were as follows: F, 5‐AACTGAGAGGCAGAGAGATG‐3; R, 5‐CTGCCTCTGTTTTTGTCTTT‐3.
3
Western Blot Analysis of Protein Extracts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lysates were generated by lysing 3 × 106 cells per sample in protein extraction buffer supplemented with a proteinase inhibitor cocktail as described before57 (link). Lysates were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-Page), samples were transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA, USA), blocked for 1 hour in a blocking buffer according to the respective antibody’s data sheet and then incubated overnight at 4 °C with primary antibodies diluted in phosphate buffered saline (PBS) with 0.1% Tween 20 (PBST) or tris buffered saline with 0.1% Tween-20 (TBST) according to data sheet: MICB (R&D Systems, Minneapolis, MN, USA) 1:1000 in PBST, acetyl-histone H3 (Lys9) (Cell Signaling Technology, Danvers, MA, USA) 1:1000 in TBST, Sp1 (Cell Signaling) 1:1000 in TBST or β-tubulin (Sigma) 1:1000 in PBST. After membranes were washed trice for 10 minutes each in the respective buffer, they were incubated for 1h with the appropriate peroxidase-coupled secondary antibodies (Dako), followed visualization using the ECL Western Blotting Substrate (Pierce, Rockford, IL, USA).
4
Investigating Anti-Fibrotic Mechanisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tubastatin A was purchased from Selleckchem (Houston, TX, United States). Antibodies to HDAC6 (#7612), Acetyl Histone H3 (Lys9) (#9649), Histone H3 (#9717), Acetyl α-Tubulin (Lys40) (#5335), α-Tubulin (#3873), Smad3 (#9523), p-Smad3 (#9520), TAK1 (#5206), p-TAK1 (#9339), Snail (#3879), PI3K (#4257), p-PI3K (#17366), AKT (#4691), p-AKT (#4060), STAT3 (#9139), p-STAT3 (#9138), CTGF (#86641), E-cadherin (#14472), STAT6 (#5397) and p-STAT6 (#56554) were purchased from Cell Signaling Technology (Danvers, MA, United States). Antibodies to Fibronectin (ab2413), MMP2 (ab37150), MMP9 (ab38898) were purchased from Abcam (Cambridge, MA). Antibody to Twist (A3237) was purchased from ABclonal (Wuhan, China). Antibodies to GAPDH (sc-32233), Collagen I (A2) (sc-28654), CD68 (sc-20060), TGFβRI (sc-399) were purchased from Santa Cruz Biotechnology (San Diego, CA, United States). Antibodies to Arginase-1 (GB11285) and CD163 (GB11340) were purchased from Servicebio (Wuhan, China). IL-4 protein was purchased from R&D Systems (Minneapolis, MN, United States). Peritoneal dialysate was purchased from Baxter Healthcare (Guangzhou, China). Antibody to α-SMA (A2547), chlorhexidine gluconate (C9394) and all other chemicals were obtained from Sigma-Aldrich (St. Louis, MO, United States).
5
Acetyl-histone H3 (Lys9) Co-immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Acetyl-histone H3 (Lys9), GR, and Nrf2 CO-IP were conducted using a Dynabead Protein A immunoprecipitation Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the recommended protocol. Briefly, beads were precleared with acetyl-histone H3 (Lys9) (1:1000; Cell Signaling Technology) for 10 min, and hippocampus tissue was extracted using NP-40 Lysis Buffer (Beyotime). Sixty µg of the sample was incubated with the beads for 15 min prior to elution. GR and Nrf2 levels were assessed in the subsequent eluant by western blotting.
6
Western Blot Analysis of Osteogenic Markers
7
Western blot analysis of protein modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blots were carried out as described previously (Currais et al., 2015b (link)). The primary antibodies used were: HRP-conjugated rabbit anti-actin (#5125, 1/20,000), acetyl-histone H3 (Lys9) (#9649, 1/100000), phospho-ACC1 (#3661, 1/2000), total ACC1 (#4190, 1/1000), phospho-AMPK (#2535, 1/1000) and total AMPK (#2793, 1/1000), from Cell Signaling Technology; histone H3 (#ab24834, 1/100000) from Abcam. Horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit, goat anti-mouse or rabbit anti-goat (BioRad) diluted 1/5000) were used.
8
Western Blot Analysis of Epigenetic and Apoptotic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen tissue samples were sectioned into small pieces and dissolved in lysis buffer containing 50 mM Tris-Cl (pH 8.0), 150 mM NaCl, 0.1% SDS, 100 μg/ml phenylmethylsulfonyl fluoride, 2 μg/ml aprotinin, 2 μg/ml leupeptin and 1% NP-40. The samples were homogenized, sonicated and kept on ice for 30 minutes. After centrifugation, the supernatant was collected for immunoblotting analysis. Cultured cells were harvested and whole cell lysates were prepared according to the method previously described [60 (link)]. Protein concentration was determined using the BCA Assay Reagent (cat#23228, Pierce, Rockford, IL). Western blotting was performed as previously described [60 (link)]. Primary antibodies were used for immunoblotting: EZH2 (#5246), SUZ12 (#3737), Tri-Methyl-Histone H3 (Lys27) (#9733), Acetyl-Histone H3 (Lys9) (#9649), Histone H3(#4499), MCL-1 (#5453), BCL2 (#2870), BCL-XL (#2764), PUMA (#4976), BAX (#5023), BAK (#6947), cleaved caspase-3 (#9664), cleaved caspase-6 (#9761), cleaved caspase-7 (#8438), cleaved caspase-9 (#9505), and cleaved PARP (#5625) from Cell Signaling Technology; EED (#17-663) from Merck Millipore; β-actin (A5316) from Sigma-Aldrich. Secondary antibodies were anti-rabbit IgG HRP (#7074) and anti-mouse IgG HRP (#7076) and purchased from Cell Signaling Technology. Antibody conjugates were visualized by chemiluminescence (ECL; cat#34076, Thermo).
9
Evaluating HDAC6 Inhibitor Tubastatin A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tubastatin A was purchased from Selleckchem (Houston, TX, USA). Antibodies to p-STAT3 (Tyr-705), STAT3, p-Smad3 (Ser423/425), Smad3, p-EGFR (Tyr1068), p-NF-κB (Ser536), NF-κB, Histone H3, Acetyl Histone H3 (Lys9), Acetyl α-tubulin (Lys40) and HDAC6 were purchased from Cell Signaling Technologies (Danvers, MA, USA). Antibodies to collagen I (A2), E-cadherin, TGF-βRI, CD68, EGFR, VEGF, CD31 and GAPDH (glyceraldehyde 3-phosphate dehydrogenase) as well as HDAC6 siRNA were purchased from Santa Cruz Biotechnology (San Diego, CA, USA). Antibody to β-actin was purchased from TransGen Biotech (Beijing, China). TNF-α, IL-1β, TGF-β1, MCP-1, IL-6 and TGF-β1 enzyme-linked immunosorbent assay (ELISA) kits were from R&D Systems (Minneapolis, MN, USA). α-SMA, DMSO and other chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA).
10
Protein Expression and Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were pelleted by centrifugation, washed once with ice-cold PBS, and lysed on ice for 30 min using the Cell Signaling lysis buffer (#9803) according to manufacturer`s extraction protocol. Protein quantitation was done using the Direct Detect system (Millipore). A total of 30 μg of protein was denatured in Laemli buffer at 95°C for 5 minutes and western immunoblotting was performed using the Bio-rad system (TGX 4–15% gels). Transfer was performed using the Trans Blot turbo system (Bio-rad) into PVDF membranes. Images were acquired by using the Bio-rad Imaging Chemidoc MP system. Secondary anti-rabbit and anti-mouse HRP-conjugated antibodies were purchased from Bio-rad (#170-6515, #170-6516). Proteins were detected using the following antibodies purchased from Cell Signaling Technology: Acetyl Histone H3 Lys9 (#9649), Caspase3 (#9668), PARP (#9542), pPRAS40 (#13175), p4EBP1 (#2855), pS6 (#4856), S6 (#2217), BTK (#3533), SYK (#13198), MyD88 (#4283), BCL10 (#4237), IRAK4 (#4363), IkBa (#4812), IKKb (#2370). c-MYC (#32072) was purchased from Abcam. Beta-Actin was from SIGMA (A5316#).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!