TRIzol (Invitrogen) and RNeasy miniprep kits (Qiagen) were used to isolate total RNA from snap-frozen muscle tissues and cells, respectively. cDNA was generated using q-Script cDNA kit (Quanta Biosciences) and quantitative PCR was performed using a Roche 480 Light Cycler with SYBR Green (Quanta Biosciences). Relative mRNA expression was determined using the comparative Ct method to normalize target genes 36B4 as internal controls. Primers are designed using PrimerBank experimentally validated sequences.
Qscript cdna kit
Manufactured by Quanta Biosciences
Sourced in United States
The QScript cDNA kit is a reagent for the reverse transcription of RNA to complementary DNA (cDNA). It contains all the necessary components to convert RNA into cDNA, which can then be used for downstream applications such as PCR, qPCR, or other DNA-based analyses.
Automatically generated - may contain errors
Lab products found in correlation
Ez rna total rna isolation kit, by Sartorius (4 mentions)
Sybr green, by Quanta Biosciences (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Rneasy miniprep kit, by Qiagen (2 mentions)
Itaq sybr green mix, by Bio-Rad (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Redtaq readymix pcr reaction mix, by Merck Group (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Quantstudio real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sensifast probe hi rox mix, by Meridian Bioscience (1 mentions)
Universal probe library probe, by Roche (1 mentions)
Abi prism 7300 sequence detection system, by Thermo Fisher Scientific (1 mentions)
10 protocols using qscript cdna kit
1
RNA Isolation and qPCR Analysis
2
Spatial-temporal Expression of CqCPAP3 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spatial-temporal expression patterns of the different CqCPAP3 genes in Cherax quadricarinatus were examined using RT-PCR. Total RNA was isolated from the molar-forming epithelium, carapace cuticle-forming epithelium, gastrolith-forming epithelium, hepatopancreas and abdominal muscle from males in four different molt-stages: inter-molt, early pre-molt, late pre-molt and post-molt; EZ-RNA Total RNA Isolation Kit (Biological Industries, Beit Haemek, Israel) was used according to the manufacturer’s protocol. First-strand cDNA was synthesized by reverse transcription using the qScript cDNA Kit (Quanta BioSciences, Gaithersburg, MD) with 1 µg of total RNA. Specific primers were used for PCR amplification (Table S1 ); PCR was performed with REDTaq ReadyMix PCR Reaction Mix (Sigma); using the following specific conditions: 94 °C for 1 min, followed by 35 cycles 94 °C for 1 min, 60 °C for 2 min, 72 °C for 3 min, followed by 10 min at 72 °C. Cq18S amplification served as a positive control.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by means of Trizol (Cat #15596018; Life Technologies, Grand Island, NY) from 30mg tissue as per manufacturer’s instructions. Reverse transcription used two μg of RNA with the qScript cDNA kit (Cat #95048; Quanta Biosciences, Beverly, MA) following kit’s instructions. cDNA was diluted 1:7 and 2μl was used per 10μl qPCR reaction. Each qPCR reaction contained 100nM primers and 5μl iTaq SybrGreen Mix (Cat #1725124; Bio-Rad, Hercules, CA). The list of primers and sequences is provided in S1 Table . CFX96 RealTime System (Bio-Rad, Hercules, CA) was used to run the qPCR reaction (95°C, 15sec; 59°C, 60sec; 40 cycles) and quantitate fluorescence. Relative fold change among biological groups was calculated using Pgk as internal normalizer.
4
Extraction and Analysis of Cassava Root RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from 100 mg of cassava roots using the Qiagen RNeasy Plant Mini kit (Qiagen, Inc., Valencia, CA, USA). To quantify RNA, absorbance was measured at 260 and 280 nm (Sambrook et al., 1989 ). Concentrations of RNA were calculated based on absorbance at 260 nm. RNA purity was judged based on the 260/280 ratio where pure RNA has a value of 2. Prior to cDNA synthesis, the RNA was treated to remove DNA contamination using the Promega DNAse treatment (Promega Corporation, Madison, WI, USA). About 2–10 μg of RNA was used for cDNA synthesis using the Qscript cDNA kit (Quanta Biosciences, Gaithersburg, MD, USA).
The cDNA was used to check for the expression of the transgene by RT-PCR. For CAS, the forward primer was CATGCTATCACAGGCAATGG while the reverse primer was GCCAAATGTTTG AACGATCGG. For NIT4 the forward primer was GCACTTGAGGGTGGATGTTT and the reverse was GCCAAATGTTTG AACGATCGG. For tubulin control, the primers TubF (TATATGGCC AAGTGCGATCCTCGACA) and TubR (TTACTCTTCATAATCCTTCTCAAGGG) were used as positive controls for the PCR reaction. The PCR reaction conditions were based on ChoiceTM Taq DNA polymerase from Denville Scientific, Inc.5
The cDNA was used to check for the expression of the transgene by RT-PCR. For CAS, the forward primer was CATGCTATCACAGGCAATGG while the reverse primer was GCCAAATGTTTG AACGATCGG. For NIT4 the forward primer was GCACTTGAGGGTGGATGTTT and the reverse was GCCAAATGTTTG AACGATCGG. For tubulin control, the primers TubF (TATATGGCC AAGTGCGATCCTCGACA) and TubR (TTACTCTTCATAATCCTTCTCAAGGG) were used as positive controls for the PCR reaction. The PCR reaction conditions were based on ChoiceTM Taq DNA polymerase from Denville Scientific, Inc.
5
Gene Expression Analysis of Adipose Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from female and male visceral WAT and subcutaneous WAT using TRIzol according to manufacturer's (Qiagen) guidelines to examine TNFa (F‐GAACTGGCAGAAGAGGCACT, R‐AGGGTCTGGGCCATAGAACT (Sutton et al., 2017 (link))), IL‐6 (F‐TGGCTAAGGACCAAGACCATCCAA, R‐AACGCACTAGGTTTGCCGAGTAGA (Sutton et al., 2017 (link))), and Ptgs‐2 (F‐ACTGGGCCATGGAGTGGACTTAAA, R‐AACTGCAGGTTCTCAGGGATGTGA (Sones et al., 2016 )) expression levels. RNA quality and quantity were assessed by spectrophotometry (NanoDrop). One thousand nanograms was used for reverse transcription using the qScript cDNA kit (Quanta BioSciences). Each qPCR was performed in triplicate with an ABI 7500 Fast Thermocycler (Applied Bioscience) using SYBR Green (QuantaBioSciences) using 25 ng cDNA. Data were analyzed using the ΔΔCT method, and results were normalized to 18 s gene (Sones et al., 2014 (link); Sones et al., 2016 ).
6
RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from embryos and larvae at different stages of embryogenesis using EZ RNA Total RNA Isolation kit (Biological Industries, Beit Haemek, Israel). First‐strand cDNA was synthesized from 1 μg of total RNA by qScript cDNA kit (Quanta Biosciences, Gaithersburg, MD, USA) according to the manufacturer's protocol. Primers for Igsf10: FOR, 5′‐TTGGCTACAGTCCCGATTTC‐3′ and REV, 5′‐AAATTTTGCTGGGACGAATG‐3′.
7
Real-Time qPCR Analysis of PGC1a Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol (catalog number 15596018; Life Technologies) from 25 mg tissue. RNA (1.5 μg) was reverse transcribed with the qScript cDNA kit (catalog number 95048; Quanta Biosciences, Beverly, MA), following the kit’s instructions. cDNA was diluted 1:14, and 2 μL was used per 10 μL real-time quantitative PCR (qPCR). Each qPCR contained 100nmol/L primers and 5 μL iTaq SYBR Green Mix (catalog number 1725124; Bio-Rad, Hercules, CA). The CFX96 RealTime System (Bio-Rad) was used to run the qPCR (95 °C, 10 seconds; 57 °C, 30 seconds; 55 cycles) and quantitate fluorescence. Relative fold change among groups was normalized to Rn45s. Primers for PCR:
PGC1a: F1 (5′ CCCACAGAAAACAGGAA 3′); R1 (5′ TGGTTGGCTTTATGAGGA 3′)
Rn45s: F1 (5′ GTAACCCGTTGAACCCCATT 3′); R1 (5′ CCATCCAATCGGTAGTAGCG 3′)
PGC1a: F1 (5′ CCCACAGAAAACAGGAA 3′); R1 (5′ TGGTTGGCTTTATGAGGA 3′)
Rn45s: F1 (5′ GTAACCCGTTGAACCCCATT 3′); R1 (5′ CCATCCAATCGGTAGTAGCG 3′)
8
Temporal Expression of Crustacean Reproduction Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Our existing M. rosenbergii embryo library (34 (link)) provides in silico temporal expression patterns for MrGPA2, MrGPB5 and MrLGR1 at different embryonic stages (day 1, day 3, day 5, day 11 and day 17) in all-male or all-female embryonic populations. These populations were produced in our laboratory using previous biotechnologies for all female population (37 (link), 38 (link)) or for all male population (39 (link), 40 (link)). To expand the temporal expression pattern to include the later developmental stages zoea 4 (larva) and post-larva 1 (PL; one day after metamorphosis), RNA was extracted from female larvae, male larvae, female PLs and male PLs (4 replicates per stage) using the EZ-RNA Total RNA Isolation Kit (Biological Industries) according to the manufacturer’s instructions. cDNA was prepared by a reverse-transcriptase reaction using the qScript cDNA kit (Quanta BioSciences) containing 1 μg extracted total RNA. qPCR was conducted to obtain the relative quantification of MrGPA2, MrGPB5 and MrLGR1 transcript levels using specific primers (Table 2 Table 2 Table 2
9
Quantifying Gene Expression in Shrimp Viral Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qPCR, total RNA was isolated from cultures infected with WSSV IE1 lentiviruses, from cultures infected with Mr-IAG lentiviruses, or from uninfected cultures (n = 7 for each). Total RNA isolation was performed using EZ-RNA Total RNA Isolation Kit (Biological Industries, Beit Haemek, Israel), and the first-strand cDNA was synthesized by reverse transcription using the qScript cDNA Kit (Quanta BioSciences, Gaithersburg, MD, United States) with 1 µg of total RNA. Relative quantification of transcript levels was performed using Roche Diagnostics FastStart Universal Probe Master Mix (Basel, Switzerland) and Roche Universal Probe Library probes. The following primers and probes were used: Probe #68 for MrLEDGF, qMrLEDGFF, and qMrLEDGFR, and Probe #25 for Mr-IAG, qMr-IAGF, and qMr-IAGR. M. rosenbergii 18S, which served as a normalizing gene, was also quantified by means of real-time RT PCR using the primers, qMr18SF and qMr18SR, Probe #106. All primer sequences are shown in Table 2. Reactions were performed with the ABI Prism7300 Sequence Detection System, Applied Biosystems (Foster City, CA, United States). Statistical analysis for relative transcript levels between the treatment groups was performed using the non-parametric Kruskal-Wallis rank sum test, followed by multiple pair-wise comparisons using the Wilcoxon rank-sum test; p < 0.05 was considered statistically significant.
10
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy miniprep kits (Qiagen) were used to isolate total RNA from cells. cDNA was generated using q-Script cDNA kit (Quanta Biosciences) and quantitative PCR was performed on an ABI Light Cycler with SYBR Green (Quanta Biosciences). Relative mRNA expression was determined using the comparative Ct method to normalize target genes 36B4 as internal controls.
Primers are designed using Primer Bank experimentally validated sequences. Primer sequences are listed in supplementary Table S2.
Primers are designed using Primer Bank experimentally validated sequences. Primer sequences are listed in supplementary Table S2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!