Tissues were removed from the adductor muscle, foot, intestine, mantle pallial, mantle edge, gill, and hemocyte and stored in RNAstore (Tiangen, Beijing, China) at -80°C. Five oysters were randomly harvested on days 3, 6, 9, 12, 19, 23, 26, 29, 33, 45 , and 77 postimplantation. The pearl sac in the mantle tissue of these oysters was carefully peeled off and immediately stored in RNAstore (Tiangen). Total RNA was extracted using Trizol (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer instructions. The RNA quality was determined by electrophoresing on a 1.5% agarose gel, and its concentration was determined by NanoDrop (Thermo Fisher Scientific) analysis.
Rnastore
Manufactured by Tiangen Biotech
Sourced in China
RNAstore is a lab equipment product designed for the storage and preservation of RNA samples. It provides a stable environment to maintain the integrity of RNA samples during storage and transportation.
Automatically generated - may contain errors
Lab products found in correlation
Buffered formalin, by Solarbio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Ms 222, by Merck Group (1 mentions)
Wistar rats, by Beijing Huafukang Biotechnology (1 mentions)
Density gradient centrifugation, by Thermo Fisher Scientific (1 mentions)
8 protocols using rnastore
1
Transcriptomics of Pearl Sac Formation
2
Blunt Snout Bream Embryonic Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All experiments were conducted following the guidelines approved by the Shanghai Ocean University Committee on the Use and Care of Animals. Blunt snout bream was obtained from the Bream Genetics and Breeding Center of Shanghai Ocean University, Shanghai, China. Fertilized eggs were generated by artificial insemination. Fertilized eggs (100–200) were plated in each Petri dish (15 cm in diameter). Egg fertilization and embryo development was carried out at room temperature (~20°C). During embryogenesis, water in the Petri dish was replaced every 4 h with well-aerated water to maintain the normal value of dissolved oxygen (DO) of 7.0 ± 0.5 mg/L (Ouyang et al., 2001 (link)). DO was monitored continuously using a dissolved oxygen meter (YSI Pro-ODO, Germany). Embryos were stored every 4 h after fertilization (0 ~ 44 hpf) by immersing in RNA Store (Tiangen, Shanghai, China) and kept in 4°C overnight and then −80°C until used. Five adult blunt snout bream were euthanized by immersion in MS-222 (Sigma, St. Louis, MO, USA). The weight of 2-year-old adult blunt snout bream was 1,000 g according to the experimental requirements. Tissues (brain, gill, eyes, muscle, skin, heart, liver, spleen, kidney, intestine, and gonad) were rapidly dissected, frozen in liquid nitrogen and stored at −80°C until use.
3
Developing a Rat Liver Fibrosis Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wistar rats (male, 7–8 weeks old, 200–220 g) were purchased from Beijing HFK Bioscience Co., Ltd. Experiments were performed under a project license (No.: 2017055) granted by the Institutional Animal Care and Use Committee of Wuhan University, in compliance with the Center for Animal Experiment/Animal Biosafety Level-III Laboratory of Wuhan University Guidelines for the care and use of animals.
Twenty-two rats were randomly divided into two groups: the control group (n = 4) and the carbon tetrachloride (CCl4) group (n = 18). Liver fibrosis/cirrhosis model was constructed by intraperitoneal injection of 40% CCl4 dissolved in maize oil (1.5 mL/kg, twice a week) for at least 8 weeks. Then, five to six rats including one belonging to the control group were sacrificed every two weeks until 16 weeks. The liver tissues were immediately stored in RNAStore (TiangenBiotech, Beijing, China) or fixed in 4% paraformaldehyde for subsequent experiments. Hematoxylin and eosin (H&E) staining and Masson’s trichrome staining were performed by Servicebio Company (Wuhan, China) and observed by an inverted microscope (Olympus IX3). Liver fibrosis stages (F1–F4) were evaluated by experienced investigators according to the Metavir system [21 (link)].
Twenty-two rats were randomly divided into two groups: the control group (n = 4) and the carbon tetrachloride (CCl4) group (n = 18). Liver fibrosis/cirrhosis model was constructed by intraperitoneal injection of 40% CCl4 dissolved in maize oil (1.5 mL/kg, twice a week) for at least 8 weeks. Then, five to six rats including one belonging to the control group were sacrificed every two weeks until 16 weeks. The liver tissues were immediately stored in RNAStore (TiangenBiotech, Beijing, China) or fixed in 4% paraformaldehyde for subsequent experiments. Hematoxylin and eosin (H&E) staining and Masson’s trichrome staining were performed by Servicebio Company (Wuhan, China) and observed by an inverted microscope (Olympus IX3). Liver fibrosis stages (F1–F4) were evaluated by experienced investigators according to the Metavir system [21 (link)].
4
Isolation of Alveolar Macrophages from BALF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BALF samples were obtained by instillation and recovery of 0.9% sterile saline in the bronchopulmonary segment21 (link)). About 3,000 mL recovered fluid was condensed immediately by centrifuged at 600×g at RT for 15 min (Shuke, Sichuan, China), and the most supernatants was discarded. Cells were isolated by density gradient centrifugation (Thermo Fisher Scientific, Rockford, IL, USA). The pellets were filtrated by sterilized double-layer gauze to remove mucus and the filtrate were centrifuged at 1,500×g at 4°C for 15 min, then the pellets from these samples was washed three times by Hank’s (Sigma, St. Louis, MO, USA). Cells layer were pipetted into eppendorf tubes and centrifuged 10 min at 1,500×g at 4°C. Finally, the cells fraction was resuspended in 1 mL RNA Store (Tiangen, Beijing, China). According to the above treatment, about 90 percent cells has already been confirmed as macrophages.22 )
5
Hypoxia Exposure in Blunt Snout Bream Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were subjected to hypoxia as recently reported (Zhang et al., 2017 (link)). During embryogenesis, water in the Petri dish was replaced with well-aerated slow-flowing water to maintain the normal value of dissolved oxygen (DO) of 7.0 ± 0.5 mg/L at room temperature (~20°C). Blunt snout bream embryos at different developmental stages (2, 8, 14, 20, and 26 hpf) were exposed to severe hypoxic DO conditions (3.5 ± 0.5 mg/L) for 6 h (see Zhang et al., 2017 (link)). Oxygen was depleted by bubbling water with nitrogen gas (Zhang et al., 2003 (link)). The embryos at similar stages under normoxic DO conditions were used as controls. After each exposure period, 20 embryos were submersed in RNA store (Tiangen, Shanghai, China), maintained at 4°C overnight, and stored at −80°C until total RNA isolation. Each experiment was performed in triplicates.
6
Cers1 Knockout Mouse Model for Oral Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both wild-type (Cers1 + /+) and Cers1 knockout (Cers1−/−) C57BL/N6 mice were obtained from VITALSTAR (Beijing, China). sgRNA for Cers1 knockout was: Cers1-gRNA1: atctgcgcataactcggcat ggg; Cers1-gRNA2: gggtggacagcgttgcgc tgg. The animals were housed in specific pathogen-free units at 24 ± 2 °C with 40%–60% humidity in a 14-hour light/10-hour dark cycle with freely accessible food at Sichuan University Animal Center (Chengdu, China). Six- to 8-week-old female mice (Cers1 + /+ C57BL/N6 mice, n = 25 and Cers1−/− C57BL/N6 mice, n = 25) were used for the experiments. A stock solution of 4NQO (Sigma, United States) was prepared at 5 mg·mL−1 (in propylene glycol). Two milliliters of stock solution was added to 100 ml of double distilled water to obtain a working concentration of 100 µg·mL−1. The mice were treated with 4NQO for 16 weeks and then observed for another 8 weeks. At the end of the experimental period, mice were sacrificed. Tongues were collected and then longitudinally bisected. The left half of the tongue was immediately fixed in 10% buffered formalin (Solarbio, China). The right half of the tongue was immediately put into RNAstore (Tiangen, China) and stored at −80 °C for RT-PCR. All animal experiments were approved by the Subcommittee on Research and Animal Care of Sichuan University (WCHSIRB-D-2017-227).
7
Carcinogen-Induced Tongue Pathology in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both wild-type (CERS1+/+) and CERS1 knockout (CERS1-/-) C57BL/N6 mice were obtained from VITALSTAR (Beijing, China). The animals were housed in speci c pathogen-free units at 24 ± 2 °C with 40-60% humidity in a 14-hour light/10-hour dark cycle with freely accessible food at Sichuan University Animal Center (Chengdu, China). Six-to eight-week-old female mice (CERS1+/+ C57BL/N6 mice, n = 25 and CERS1-/-C57BL/N6 mice, n = 25) were used for the experiments. A stock solution of 4NQO (Sigma, United States) was prepared at 5 mg/ml (in propylene glycol). Two milliliters of stock solution was added to 100 ml of double distilled water to obtain a working concentration of 100 µg/ml. The mice were treated with 4NQO for 16 weeks and then observed for another 8 weeks. At the end of the experimental period, mice were sacri ced. Tongues were collected and then longitudinally bisected. The left half of the tongue was immediately xed in 10% buffered formalin (Solarbio, China). The right half of the tongue was immediately put into RNAstore (Tiangen, China) and stored at - 80 °C for RT-PCR. All animal experiments were approved by the Subcommittee on Research and Animal Care of Sichuan University (WCHSIRB-D-2017-227).
8
Grass Carp Developmental Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Grass carp were acquired from the aquatic breeding base of the Pearl River Fishery Research Institute, Chinese Academy of Fishery Sciences located in Guangzhou, China. Three juveniles were selected randomly with body weights of 58 ± 0.5 g. 11 tissues -heart, liver, spleen, kidneys, gonads, muscle, foregut, midgut, hindgut, brain, and pituitary glandwere removed for total RNA extraction and expression analysis. A pair of healthy grass carp (female, 12.5 kg; male, 9 kg) was mated and samples of 12 early developmental stages were obtained, including unfertilized eggs, fertilized eggs, blastocyst, late-stage gastrula, neurula, and organogenesis stages; specimens were also obtained at 0, 24, 48, 72, 120, and 144 h after hatching. Total RNA extracted from the samples was used to assess gene expression levels during the early stages of development (3 samples per stage). Samples were collected and maintained in RNA Store (Tiangen Biotech Co., Beijing, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!