After the 10 days course of treatment all animals were sacrificed, and popliteal lymph nodes of each infected footpad were collected for parasite load determination. Genomic DNA was extracted from the lymph nodes (DNeasy Blood and Tissue kit, Qiagen). Equal concentration of samples (125 ng) was applied to quantify leishmania kDNA with primers RV1(forward: 5’-CTTTTCTGGTCCCGCGGGTAGG-3’ ) and RV2 (reverse: 5’-CCACCTG GCCTATTTTACACCA-3’ ). qPCR data was normalized using the murine house-keeping gene GAPDH amplified with primers (forward:5’CGTCCCGTAGACAAAATGGT3’ ; reverse: 5’TTGATGGCAACAATCTTCAC3’ ) in parallel using Maxima SYBR green qPCR master (Thermo). qPCR was performed using Biorad CFX96 device with 95°C/ 10 min (initial denaturation), then 95°C/15s (denaturation), 60°C /30s (annealing) and 72°C/ 40s (extension) over 40 cycles. For ΔCT calculation of samples, every CT were subtracted from the same on GAPDH. Then, ΔΔCT of each group was normalized according to negative control group (DMSO).
Maxima sybr green qpcr master
Manufactured by Thermo Fisher Scientific
Sourced in United States
Maxima SYBR green qPCR master is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains all the necessary components, including SYBR Green I dye, Taq DNA polymerase, dNTPs, and buffer, optimized for sensitive and reproducible gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using maxima sybr green qpcr master
1
Quantifying Leishmania Parasite Load
2
Quantitative Analysis of Immune Markers in AML-12 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from AML-12 cells or liver tissues using TRIzol reagent in accordance with the manufacturer’s protocol, and the concentrations and purity of RNA were measured using a Nanodrop 2000 (Thermo Scientific, USA). Single-strand cDNA was generated utilizing a Transcripter Synthesis Kit. The relative levels of objective mRNAs (P2Y2R, TNF-α, IL-1β) were determined through qPCR analysis with a PikoRreal 96 Real-Time PCR detection system (Thermo Scientific, USA) using Maxima SYBR Green qPCR Master. The primer sequences used in the study were designed and synthesized via Sangon Biotech (Shanghai, China) as follows: P2Y2R (forward: 5′-ATA TCA GCC CCT TTA ACA AGC-3′ and reverse: 5′-CAG TCA GCA GTG ACG ACT CAA-3′); TNF-α (forward: 5′-CAG GTC ACT GTC CCA GCA TCT-3′ and reverse: 5′-GAG TCC GGG CAG GTC TAC TTT-3′); IL-1β (forward: 5′-GGT AAG TGG TTG CCC ATC AGA-3′ and reverse: 5′-GTC GCT CAG GGT CAC AAG AAA-3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!