Virus genome dna rna extraction kit

Taq DNA polymerase and dNTPs were purchased from TaKaRa Company; DL 2000 DNA Marker was purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.; agarose was purchased from OXOID Company; 1 × TAE electrophoresis solution, EB nucleic acid dye, PBS solution (pH 7.4, 0.01 M, containing 1000 units/mL penicillin), and virus genome DNA/RNA extraction kit were purchased from Tiangen Biochemical Technology Co., Ltd., Beijing, China; Gel Extraction Kit D2500 was purchased from OMEGA; pMD 19-T vector was purchased from Baobio Engineering Co., Ltd. (Dalian, China); DH5α competent cells were purchased from Thermo Scientific; SPF chicken embryos were purchased from Sichuan Huapai Bioengineering Group Co., Ltd., Jianyang, China; MDCC-MSB1 cells were preserved by our laboratory.

For DNA extraction for IL-28B gene detection, we used a blood genomic DNA extraction kit (Tiangen, Beijing, China). For HCV RNA extraction, we used the MinElute column QIAamp method and the virus genome DNA/RNA extraction kit (Tiangen). All extracted DNA/RNA were then immediately used for gene detection or stored at −80 °C.

HEK-293T cells were used for PRV-PTC amplification and infectivity assays. Eighty percent confluent HEK-293T cells were transfected with 3 µg of Arg-tRNA^UGA or the empty vector pUC57. Twenty-four hours after transfection, the rescued PTC-containing virus was collected and centrifuged at 1000 × g for 5 min, followed by filtration through a 0.45-µm filter to remove the cell debris before a new round of infection in DMEM supplemented with 2% FBS. The PTC-containing virus was passaged 3 times in the presence of Arg-tRNA^UGA. A parallel experiment in which the cells were transfected with pUC57 was conducted as a negative control.
After each passage, viral DNA was extracted from 200 µL of the cell supernatant mixture using the Virus Genome DNA/RNA Extraction Kit (Tiangen, Beijing) according to the manufacturer’s procedure. The PTC-gB fragment of PRV-PTC was amplified by PCR followed by genome sequencing to detect the genetic stability of PRV-PTC virus during viral passaging. The primers used for PCR and sequencing are as follows: F: CGTCTTTGGCCTGCTCCACACCACG; R: CGCCGATCTTGGTGTAGGTGTCGTTG.