Biosystems quantstudio 7 flex real time pcr system

Total RNA was extracted with an RNAiso Plus Reagent (Takara BIO, Shiga, Japan). cDNA was prepared using PrimeScript RT reagent Kit with gDNA Eraser (Takara BIO, Shiga, Japan). Quantitative PCR was performed using SYBR Premix Ex TaqII (Takara BIO, Shiga, Japan) by the Biosystems QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific, Hudson, NH, USA). The amplifications were performed in triplicate and normalized to β-actin. The 2-^ΔΔCt method was used to calculate relative gene expression levels. Primer sequences are as follows: CXCL1 forward primer CTGGGATTCACCTCAAGAACATC, CXCL1 reverse primer CAGGGTCAAGG-CAAGCCTC; β-actin forward primer GGCTGTATTCCCCTCCATCG, β-actin reverse primer CCAGTTGGTAACAATGCCATGT. Triplicate independent experiments were repeated.

Total RNA was extracted with RNAiso Plus Reagent (Takara BIO, Shiga, Japan) and reverse transcribed to complementary cDNA using the PrimeScript™ RT reagent Kit (Takara, Shiga, Japan) following the manufacturer’s instructions. Briefly, total RNA was extracted and then evaluated by measuring the A260/A280 ratio. Complementary DNA was generated from 1 g total RNA by reverse transcription after gDNA erasing. RT-PCR was performed using the SYBR Premix Ex Taq Kit II kit (Takara BIO, Shiga, Japan) and Biosystems QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific, Hudson, United States). PCR amplicons were detected by fluorescent detection of SYBR green. The relative mRNA levels were compared using the 2-^ΔΔCt method.