Total RNA was extracted from transfected cells using the Trizol reagent (Invitrogen #10296010) and subjected to further processes with a RevertAid First Strand cDNA Synthesis Kit (Invitrogen #K1622, Thermo Fisher Scientific) and Luna® Universal Probe qPCR Master Mix kit (NEB #M3003, New England BioLabs). The forward and reverse primer sequence was 5′‐GACATGGAGCATGGATGGGAA‐3′ and 5′‐GTTCGGCCTAAATTGTCCACT‐3′, respectively. The reaction conditions have been described previously (Kuang et al., 2020 (link)). Results were obtained using the 2−ΔΔCt method (Livak & Schmittgen, 2001 (link)).
Luna universal probe qpcr master mix kit
Manufactured by New England Biolabs
The Luna® Universal Probe qPCR Master Mix kit is a ready-to-use solution for quantitative polymerase chain reaction (qPCR) analysis using probe-based detection. The kit contains all the necessary components, including a hot-start DNA polymerase, dNTPs, and buffer, to perform sensitive and specific qPCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using luna universal probe qpcr master mix kit
1
Quantitative Analysis of Gene Expression
2
Quantitative Real-time PCR for Gene Dosage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative Realtime PCR was performed using the Luna ® Universal Probe qPCR Master Mix kit (New England Biolabs Inc) according to the manufacturer's instructions.
Primers used for the RT-qPCR reactions were tested by end-point PCR and the PCR products were sequence verified. Approx. 10 ng of the genomic DNA from transformant lines was used as template. A 195 bp fragment of the EYFP gene was amplified using the primers P11 and P12 with the condition of denaturation at 95 °C for 15 s, and 40 cycles of annealing and extension at 60 °C for 30 s. The singlecopy PpCYP701B1 gene was used as an internal reference and a 189 bp fragment was amplified using primers P13 and P14. The RT-qPCR was performed with three technical repeats and two biological replicates for each line. The relative EYFP gene dosage (N) of the RT/EYFP transformant lines were determined relative to that of the Pp108/EYFP transformant line following the equation below (Pfaffl 2004) .
where E is the efficiency of the qPCR reaction for that particular primer pairs; control and sample represent the Pp108/ EYFP line R and RT/EYFP line, respectively.
Primers used for the RT-qPCR reactions were tested by end-point PCR and the PCR products were sequence verified. Approx. 10 ng of the genomic DNA from transformant lines was used as template. A 195 bp fragment of the EYFP gene was amplified using the primers P11 and P12 with the condition of denaturation at 95 °C for 15 s, and 40 cycles of annealing and extension at 60 °C for 30 s. The singlecopy PpCYP701B1 gene was used as an internal reference and a 189 bp fragment was amplified using primers P13 and P14. The RT-qPCR was performed with three technical repeats and two biological replicates for each line. The relative EYFP gene dosage (N) of the RT/EYFP transformant lines were determined relative to that of the Pp108/EYFP transformant line following the equation below (Pfaffl 2004) .
where E is the efficiency of the qPCR reaction for that particular primer pairs; control and sample represent the Pp108/ EYFP line R and RT/EYFP line, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!