Chip dna clean and concentrator kit

ChIP was performed using Magna-ChIP-Kit (Merck, Germany) as described (Salcher et al., 2014 (link)). 20 µl protein-G-magnetic-beads were coupled to 7.5 µl of FOXO3 antibody (Santa Cruz, Dallas, USA) or control-IgG and incubated with nuclear lysates of shredded DNA from 2 × 10⁷ cells. After precipitation, protein was digested by proteinase-K and DNA was concentrated with ChIP-DNA-Clean- and -Concentrator-Kit (Zymo Research, USA). FOXO3-binding to DNA was quantified by qPCR using promoter-specific primers for FOXO3-targets.

ChIP assays were performed according to the X-ChIP protocol from Abcam (http://www.abcam.com/protocols/cross-linking-chromatin-immunoprecipitation-x-chip-protocol), with the following modifications: after formaldehyde fixation, cells were rinsed three times with 10 ml ice cold PBS and centrifuged at 1,200 rpm, 5 min, 4°C. The cell pellet was resuspended in 600 μl lysis buffer per 1x10⁷ cells. For immunoprecipitation, 3–5 μg of specific antibody and 25 μl blocked protein G beads were used (antibodies employed for ChIP analysis are listed in S2 Table). Immunoprecipitated samples were washed three times in low salt wash buffer and three times in high salt wash buffer. Precipitated DNA was isolated using the ChIP DNA Clean and Concentrator Kit (Zymo Research) according to the manufacturer´s manual and analysed by qPCR. DNA enrichment was calculated as percentage of the input. Bar graphs show the mean and standard deviation of at least two independent experiments, each performed in duplicates.
DNA oligonucleotides that were used as primers for ChIP PCR analyses are listed in S1 Table.

ChIP assays using anti-CBFβ^{26 (link)} and SATB1 (ab70004, Abcam) antibodies were performed as follows^{58 (link)}. In brief, CD4⁺ or CD8⁺ T cells were enriched by MACS magnetic beads (Miltenyi Biotec) and crosslinked with 1.0% formaldehyde for 10 min at room temperature. The reaction was stopped by adding final 0.15 M glycine and the cells were washed extensively with PBS. Fixed cells were lysed with lysis buffer containing 0.5% NP-40 and 0.25% Triton X-100, and nuclei pellets were resuspended in sonication buffer containing 0.1% Sodium deoxycholate and 0.5% N-laurylsarcosine sodium salt. The nuclei were sonicated using XL2000 ultrasonic cell disruptor (Microson) at output level 6 for 15 s between 8 and 10 times to yield 200–300 bp fragments. Sonicated chromatin was immunoprecipitated by either 1 μg of anti-CBFβ or anti-SATB1 antibody. Captured DNA fragments were washed with RIPA buffer and purified by the ChIP DNA Clean and Concentrator Kit (Zymo Research). The primers used for the ChIP-qPCR is provided in Supplementary Table 1.

Chromatin immunoprecipitation (ChIP) was performed on Tsc2^+/+ and Tsc2^-/- MEFs and human TSC2— and TSC2++ cells using the Magna ChIP kit (Millipore, Burlington, MA) and monoclonal anti-STAT3 antibody (Millipore, Burlington, MA) as described https://www.protocols.io/private/12361d13ea65a41e2d2a98f529d6a745. Input and IP DNA samples were purified using ChIP DNA Clean and Concentrator kit (Zymo Research, Irvine, CA). qPCR analysis of chromatin pull-down was performed using primers amplifying regions containing STAT3 binding sites within IGF2 promoters. The amounts were normalized to the level of input chromatin material prior to immunoprecipitation. Reproducibility between biological replicates was statistically assessed using 2-way ANOVA. The following DNA primers were used: Mouse Igf2_P2_Forward: GGCCCCATAATTTAGGAACCCA; Mouse Igf2_P2_Reverse: TTTGGAGTACCTGAATTTGGGGG. Mouse Igf2_P5_Forward: AAGAGTCAAGCCAGACCCCA; Mouse Igf2_P5_reverse: ATTTCTGCCCTTCTGAGCCC. Human IGF2_P2 forward: GCCATTTTACCAGTGCCACG; Human IGF2_P2_reverse: CTAGGAGGTGGGGGCTATGT. Human IGF2_P4_Fw: CTAGCGTTGCCCAAACACAC; Human IGF2_P4_reverse: CCCAGTCCGTTGGAAGACC.

Prior to ChIP experiments, two 15 cm dishes were seeded with 3 × 10⁶ cells per dish and treated with TGFβ1 or solvent for 24 h. After treatment, chromatin was prepared using the truChIP chromatin shearing kit (#520154, Covaris, Woburn, MA, USA) with the following two modifications. First, nuclei were isolated following the NEXSON protocol [32 (link)], using the Bioruptor Plus sonicator device (Diagenode, Seraing, Belgium) applying 5 cycles of sonication (15 s on/30 s off) with the low amplitude setting. Second, chromatin shearing was performed using the Bioruptor Plus for 50 cycles (30 s on/30 s off) with the high amplitude setting. All probes were gently mixed every 10 cycles. The concentration of isolated chromatin was determined in a NanoDrop 2000 device (ND-2000, Thermo Fisher Scientific). JUNB immunoprecipitations were carried out using 50 µg of chromatin and Dynabeads Protein G (#10003D, Thermo Fisher Scientific) but otherwise following the protocol provided in the truChIP chromatin shearing kit. After immunoprecipitation, the subsequent washing steps, reversal of crosslinking, and qPCR analyses were carried out as previously described [30 (link)], except that DNA was purified with the ChIP DNA Clean and Concentrator kit (#D5205, Zymo Research, Irvine, CA, USA).

The assay was performed with 1 × 10⁶ cells per assay using the ChIP-IT Express Enzymatic Kit (Active Motif, USA), following the manufacturer’s protocol. Briefly, fixed cells were lysed and subjected to an enzymatic shearing cocktail for 10 min to cut chromatin. After immunoprecipitation, DNA was recovered using an elution buffer (10% SDS, 300 mM NaCl, 10 mM Tris-HCl, and 5 mM EDTA; pH 8.0) at 65 °C overnight and then collected using the ChIP DNA Clean and Concentrator Kit (Zymo Research, USA). The 10% input (DNA without IP) and normal mouse IgGs (mIgG) were used as the positive and negative controls, respectively.