The cloning of PAP cDNA into NT198 under the control of GAL1 promoter used in this study was described previously 7 (link)73 (link) . AtBI-1 (AB025927) was cloned into the yeast expression vector pYES2.1 (pYES2.1 TOPO TA expression kit, Invitrogen, USA) in upstream of V5 epitope by PCR using 5’GGATCCACGATGGATGCGTTCTCTTCCTTC3’ and 5’GTTTCTCC-TTTTCTTCTTCTTCTC3’ primers and into the pTKB175 without a tag. After the cloning, vectors were transformed into E. coli DH5α. The sequences were confirmed by sequencing two times using specific primers.
Pyes2.1 topo ta expression kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PYES2.1 TOPO® TA Expression Kit is a molecular biology tool designed for the direct cloning and expression of Taq polymerase-amplified PCR products in Escherichia coli. The kit provides a plasmid vector and necessary components for the rapid, efficient, and directional insertion of PCR products into an expression vector, enabling the expression of recombinant proteins.
Automatically generated - may contain errors
5 protocols using pyes2.1 topo ta expression kit
1
Cloning of PAP and AtBI-1 in Yeast
2
Cloning of Human Top2α Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Top2α gene was amplified by PCR from the Saccharomycescerevisiae expression plasmid pWOB6-HsTop2 using a C-terminal primer containing a PreScission Protease (PsP) cleavage sequence followed by a 10-histidine tag. In this construct, the first five residues of S. cerevisiae Top2α are fused to the 29th residue of HsTop2a. PCR inserts were ligated in the yeast expression plasmid pYES2.1, a high-copy episomal vector for galactose-inducible expression of proteins in Saccharomyces cerevisiae (pYES2.1 TOPO TA Expression Kit, Invitrogen). Sequencing of the plasmid confirmed the insertion of the Top2 gene without any mutation.
3
C-terminal Protein Fusion with V5 Epitope
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate C-terminal fusion proteins with the V5 epitope, cDNA fragments with each stop codon removed were amplified by PCR using primer 7 and 8 for VvSTO2, primer 9 and 10 for VvSTO4, and primer 11 and 12 for VvSTO6 (Supplementary Table S1 ), and cloned into the pYES2.1/V5-His-TOPO® vector via a pYES2.1 TOPO® TA expression kit (Invitrogen) in accordance with the provided protocol. The resulting construct and the empty pYES2 vector (Invitrogen) as a control were transformed to the BJ2168 yeast strain (MATa, prc1-407, prb1-1122, pep4-3, leu2, trp1, ura3-52, gal2; Nippon Gene) as previously described (Gietz and Schiestl, 2007 (link)).
4
Cloning and Expression of SaNramp6 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frame of SaNramp6 was amplified by PCR using High Fidelity KOD-Plus DNA Polymerase (Toyobo, Japan) from the cDNA of S. alfredii using the specific primers SaNramp6-GF and SaNramp6-R (Table 1 ). The yeast expression vector pYES2.1 -SaNramp6 was generated using pYES2.1 TOPO® TA Expression Kit (Invitrogen, Carlsbad, USA). For subcellular location and plant expression vector, the purified PCR products were then cloned into the Gateway entry vector pENTR/D-Topo (Invitrogen, Carlsbad, USA) and positive clones were further sequenced to verify the direction and sequence accuracy. The sequence-verified plasmid was then recombined in pK7WGF2.0 and pH2GW7.041 (link) to generate pK7WGF2.0-SaNramp6 and pH2GW7.0-SaNramp6, respectively.
5
Constructing GPD1 expression vectors in yeast
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids expressing the S. cerevisiae or S. kudriavzevii GPD1 gene under GAL promoter were constructed using pYES2.1 TOPO® TA Expression Kit (Invitrogen) following manufactures’ instructions. Plasmids expressing the S. cerevisiae or S. kudriavzevii GPD1 gene under its own promoter were constructed using pGREG526 by homologous recombination in yeast [24] (link). To construct a version with GDP1 promoter from S. cerevisiae and a recombinant GPD1 coding sequence from S. cerevisiae and S. kudriavzevii (pGREG526-GPD1Scer-Skud), the plasmid pGREG526-GPD1Scer, linearized with XhoI and AatII, was co-transformed with a PCR product containing GPD1Skud. All constructions were confirmed by sequencing. The primers used are described in Table 2 . To study gene diversity, S. cerevisiae and S. kudriavzevii IFO1802 sequences were obtained from Saccharomyces Genome Database [25] and S. kudriavzevii ZP591 sequence was obtained from http://www.saccharomycessensustricto.org [26] (link). Gpd1p enzyme structure models were built using MODWED online server based on Modeller software [27] (link). Three individual statistical scores (e-value, z-Dope and GA341) where used to check the model quality and the models of the two species where considered reliable. Structures were visualized with Pymol viewer [28] .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!