Liver tissues and αTC1–6 cells were homogenized in Sepasol-RNA I Super G solution (Nacalai Tesque), and total RNA was isolated using a conventional phenol-chloroform-based RNA extraction method. Pancreatic islet RNA was purified with an RNeasy Micro Kit (Qiagen, Valencia, CA). cDNA was prepared using a PrimeScript RT reagent kit and gDNA Eraser (RR047A; TaKaRa Bio, Inc., Shiga, Japan). Quantitative PCR (qPCR) was performed using SYBR Premix Ex Taq II (RR820A; TaKaRa Bio, Inc.) and an ABI 7300 thermal cycler (Applied Biosystems, Foster City, CA). For each gene, mRNA levels were determined by the comparative Cycle threshold (Ct) method (ΔΔCt) and levels of each mRNA were normalized to 18S rRNA or TATA-binding protein (Tbp) mRNA. Primer sequences for Cltrn, Slc2a2, Hnf4a, Hgfac, Agxt, G6pc, Got1, Sglt1, Sglt2, and Slc2a1 mRNAs are listed in Supplementary Table 1 .
Sepasol rna 1 super g solution
Manufactured by Nacalai Tesque
Sourced in Japan
Sepasol-RNA I Super G solution is a reagent used for the extraction and purification of RNA from various biological samples. It is designed to effectively isolate high-quality RNA while maintaining its integrity.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Revertra ace qpcr rt master mix with gdna remover, by Toyobo (2 mentions)
Gdna eraser, by Takara Bio (1 mentions)
Abi 7300 thermal cycler, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Dnase 1, by Takara Bio (1 mentions)
Nucleospin rna 2 system, by Macherey-Nagel (1 mentions)
Stepone system, by Thermo Fisher Scientific (1 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
Kod sybr qpcr master mix, by Toyobo (1 mentions)
Stepone real time pcr, by Thermo Fisher Scientific (1 mentions)
Thunderbird qpcr mix, by Toyobo (1 mentions)
Stepone real time system, by Thermo Fisher Scientific (1 mentions)
Kod sybr qpcr mix, by Toyobo (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Abi 7300, by Thermo Fisher Scientific (1 mentions)
Truncated t4 rna ligase 2, by New England Biolabs (1 mentions)
T4 rna ligase 1, by New England Biolabs (1 mentions)
7 protocols using sepasol rna 1 super g solution
1
Gene Expression Analysis of Liver and Pancreatic Tissues
2
Extraction and Quantification of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from mouse tissues, except brain, was extracted using Sepasol-RNA I Super G solution (Nacalai Tesque) according to the manufacturer’s instructions and then treated with DNase I
(Takara, Shiga, Japan) to digest potentially contaminating genomic DNA. For extracting RNA from brain, a NucleoSpin RNAII system (Macherey-Nagel, Düren, Germany) was used in which DNase for
digestion of contaminated genomic DNA was included. cDNA was reverse transcribed from RNA using a SuperScript VILO cDNA synthesis kit (Thermo Fisher). Synthesized cDNA was used for
quantitative polymerase chain reaction (qPCR) in a PCR reaction mixture of THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan) using the StepOne system (Thermo Fisher). The fold difference was
calculated using the ΔΔCt method [38 (link)] with Gapdh as the reference. Primer sequences were as follows: for
Ptbp1, forward GGTCTCTTCCGTGTGCCATG and reverse CTGCGCTCCTGTTGTCACCT, and for Gapdh, forward ATGAATACGGCTACAGCAACAGG and reverse
CTCTTGCTCAGTGTCCTTGCTG.
(Takara, Shiga, Japan) to digest potentially contaminating genomic DNA. For extracting RNA from brain, a NucleoSpin RNAII system (Macherey-Nagel, Düren, Germany) was used in which DNase for
digestion of contaminated genomic DNA was included. cDNA was reverse transcribed from RNA using a SuperScript VILO cDNA synthesis kit (Thermo Fisher). Synthesized cDNA was used for
quantitative polymerase chain reaction (qPCR) in a PCR reaction mixture of THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan) using the StepOne system (Thermo Fisher). The fold difference was
calculated using the ΔΔCt method [38 (link)] with Gapdh as the reference. Primer sequences were as follows: for
Ptbp1, forward GGTCTCTTCCGTGTGCCATG and reverse CTGCGCTCCTGTTGTCACCT, and for Gapdh, forward ATGAATACGGCTACAGCAACAGG and reverse
CTCTTGCTCAGTGTCCTTGCTG.
3
Analysis of Zebrafish Brain Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression levels of various genes were analyzed using cDNAs obtained from zebrafish brains. The brains of Neu1-KO and WT zebrafish were dissected after anesthesia with ice water. Total RNA was extracted from the zebrafish brain using Sepasol-RNA I Super G solution (Nacalai Tesque, Kyoto, Japan), followed by cDNA synthesis using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan).
Real-time PCR was conducted by StepOne real-time PCR (Thermo Fisher Scientific, Waltham, MA) using KOD SYBR qPCR Master Mix (TOYOBO) and specific primers for genes of neu1, lysosomal-associated membrane proteins 1a and 1b (lamp1a and lamp1b, respectively), cathepsin A (ctsa), beta-galactosidase 1 (glb1), N-acetylgalactosamine-6-sulfatase (galns), transcription factor EB (tfeb), isotocin (ist), mineralocorticoid receptor (mr), melanin-concentrating hormone (mch), arginine vasotocin (avt), neuropeptide Y (npy), orexin (orx), and tyrosine hydroxylase 1 and 2 (th1 and th2, respectively; Supplementary Table1 ). A standard curve for relative data quantification was derived from the serial dilutions of cDNA (Pffafl method). Normalization to the level of actb mRNA was done to compensate for the quality and quantity of mRNA in each sample.
Real-time PCR was conducted by StepOne real-time PCR (Thermo Fisher Scientific, Waltham, MA) using KOD SYBR qPCR Master Mix (TOYOBO) and specific primers for genes of neu1, lysosomal-associated membrane proteins 1a and 1b (lamp1a and lamp1b, respectively), cathepsin A (ctsa), beta-galactosidase 1 (glb1), N-acetylgalactosamine-6-sulfatase (galns), transcription factor EB (tfeb), isotocin (ist), mineralocorticoid receptor (mr), melanin-concentrating hormone (mch), arginine vasotocin (avt), neuropeptide Y (npy), orexin (orx), and tyrosine hydroxylase 1 and 2 (th1 and th2, respectively; Supplementary Table
4
Quantifying Zebrafish Brain Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression levels of each gene were analyzed using cDNAs from the zebrafish brain using a Step One Real-Time System (Thermo Fisher Scientific, MA). Zebrafish brains were removed after euthanasia with 0.1% tricaine. Tricaine has been used in many studies on anxiety in fish and has been reported to have no effect on anxiety or stress-related behaviors (Nordgreen et al., 2014 (link)). Total RNA was extracted from the zebrafish brains using Sepasol-RNA I Super G solution (Nacalai Tesque, Kyoto, Japan), and cDNA synthesis was performed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). Real-time PCR was conducted using KOD SYBR qPCR Mix or THUNDERBIRD qPCR Mix (TOYOBO). The specific primers used for PCR are listed in Supplementary Table S1 . The expression level of actb mRNA was used as an internal standard to compensate for the quality and quantity of mRNA in each sample. Primers were designed by using NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ).
5
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen tissues were homogenized in Sepasol-RNA I Super G Solution (Nacalai Tesque, Inc., Kyoto, Japan). Total RNA was extracted using the phenol-chloroform extraction method, and cDNA was synthesized from total RNA using a Prime Script RT Kit (RR047A; Takara). qRT-PCR was performed on an ABI 7300 thermal cycler (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq II (RR820A; Takara). Relative gene expression was normalized by the mRNA expression level of mouse TATA-binding protein. The primer sequences are shown in Supplementary Table S1 .
6
Grass-clump Dwarfism miRNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the first screening of miRNA associated with the grass-clump dwarfism via small RNA sequencing, total RNA was extracted from crown tissues of WT and type II necrosis lines grown at normal temperature and 4°C under long-day (18-h light and 6-h dark) conditions for 8 weeks using Sepasol-RNA I Super G solution (Nacalai Tesque, Kyoto, Japan). For each sample, crown tissues of at least two independent plants were bulked with no biological replications. Small RNA libraries were prepared using a TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA) and RNA 3’ adapter and RNA 5’ adapter were respectively added using truncated T4 RNA ligase 2 (New England BioLabs, Ipswich, MA, USA) and T4 RNA ligase 1 (New England BioLabs). cDNA was synthetized using the 3’ adapter-recognizing primer, and after PCR, products of around 150 bp were selected. Single-end sequencing was performed with a TruSeq SBS Kit v3-HS (Illumina) on a HiSeq2000 platform (Illumina) according to the manufacturer’s instructions. Files containing raw sequence data were deposited in the sequence read archive of DDBJ (accession number DRA004554).
7
Mouse Inner Ear Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The inner ear regions of the mouse embryo were carefully clipped with a biopsy punch (1–3 mm diameter, Kai Medical, Japan) at Tokyo Medical and Dental University. The tissues were quickly submerged into RNAlater solution (Invitrogen) and then homogenized in Sepasol-RNA I Super G solution (Nakarai Tesque, Japan). Total RNA was isolated from tissue samples using the RNeasy Micro Kit (Qiagen, Germany) following the manufacturer’s instructions. Sequencing was performed on the NovaSeq6000 (Illumina) platform (150 bp paired end, 3.9 Gbp throughput on average).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!