Itaq universal sybr green mix

RNA was collected from human cell lines lysates (myoblasts, NHDF, 381T, SMS-CTR, RH30, RH5) using Qiagen RNeasy Plus Mini Kit (Qiagen, Germantown, MD). cDNA was then generated using High Capacity cDNA Reverse Transcription Kit from Applied Biosystems (Foster City, CA). RT-PCR reactions were then run with iTaq Universal SYBR Green mix on a CFX Connect Real Time System (BioRad, Hercules, CA). RT-PCR primers used are listed below: GRK5 FWD – GTCTGTCCACGAGTACCTGA; REV – CAGGCATACATTTTACCCGT; NFAT1 FWD - ACGAGCTTGACTTCTCCACC; REV - TGCATTCGGCTCTTCTTCGT

The total liver RNA was isolated using TRIzol® reagent (Invitrogen) according to the manufacturer's protocol. Tissue/TRIzol® mixtures were homogenized using an Ultra-Turrax homogenizer, while keeping the viscosity of the solution to a minimum to ensure effective inactivation of endogenous RNase activity. The RNA samples were subjected to DNase treatment to remove genomic DNA contamination. A total of 1 μg of total RNA was used to generate cDNA in a 20 μL reaction volume using Superscript II Reverse Transcriptase (HT Biotechnology, Cambridge, UK). PCR primers were designed using Primer Express version 2.0 (Invitrogen). β-Actin mRNA expression was used for normalization. Primers used were as follows:
β-actin: 5′-CTGCTCTTTCCCAGATGAGG-3′ (sense) and 5′-CCACAGCACTGTAGGGGTTT-3′ (anti-sense);
POLG: 5′-GAAGAGCGTTACTCTTGGACCAG-3′ (sense) and 5′-AACATTGTGCCCCACCACTAAC-3′ (anti-sense);
PGC-1α: 5′-GTCAACAGCAAAAGCCACAA-3′ (sense) and 5′-GTGTGAGGAGGGTCATCGTT-3′ (anti-sense);
MnSOD: 5′-CCAAAGGAGAGTTGCTGGAG-3′(sense) and 5′-GAACCTTGGACTCCCACAGA-3′ (anti-sense).
An equivalent of 25 ng of total RNA was subsequently used in the amplification with 50 nM of gene-specific primers and 4 mL of iTaq Universal SYBR Green mix (Bio-Rad Laboratories, Hercules, CA, USA) in a total volume of 8 μL using standard cycle parameters on a Bio-Rad iQ5.

RNA quantification was performed as described earlier (14 (link)). Briefly, infected cells were harvested, and RNA was stabilized by addition of RNA Protect (Qiagen, Venlo, Netherlands) and incubation for 5 min at room temperature. The suspensions were then centrifuged at 5,000 × g for 10 min. The supernatant was removed, and pellet was kept at −80°C. RNA was extracted from the pellet using an RNeasy Plus kit (Qiagen). DNA was removed by selective digestion with DNase from an Ambion DNA-free kit (Thermo Fisher Scientific, Waltham, MA). cDNA was then synthesized by reverse transcription using a Goscript reverse transcription system (Promega), and spoIID^Wch cDNA was quantified by qPCR performed on 4 μl of cDNA mixed with 10 μl of iTaq Universal SYBR green mix (Bio-Rad), 4.8 μl of water, and 0.6 μl each of primers SpoIID_RT_F and SpoIID_RT_R (Table S2) or 16S rRNA-specific primers WadF4 and WadR4 (32 (link)). qPCR was performed using a StepOne Plus real-time PCR system (Applied Biosystems, Waltham, MA) under the following conditions: 3 min of denaturation at 95°C followed by 45 cycles of 15 s of denaturation at 95°C and 1 min of annealing/elongation at 60°C.