Quantitec reverse transcription

RNA was purified using RNeasy kits (Qiagen, Les Ulis, France). The concentration of RNA was quantified by spectrophotometry (SmartSpec™ 3000, Biorad, Hercules, CA, USA). Total RNA (500 ng) was reverse transcribed with the QuantiTec Reverse Transcription (Qiagen Kit) into cDNA. PCR amplification was performed on a LightCycler (Roche Diagnostics, Switzerland) using Fast-Start™ DNA Master SYBR Green I real-time PCR kit (Roche Molecular Biochemicals, Switzerland). The expression of the genes was normalized to the expression of human cyclophilin B (CPB) (5′tgtggtgtttggcaaagttc3′; 3′gtttatcccggctgtctgtc5′) (Qiagen). The list of primers (Qiagen) is as follows: BMP2 (5′ccaccatgaagaatctttgga3′; 3′gagttggctgttgcaggttt5′), RUNX2 (5′gtggacgaggcaagagttt3′; 3′tggggtctgtaatctgactc5′), Wnt5a (5′attcttggtggtcgctaggt3′; 3′accttcgatgtcggaattgat5′).

RNA was purified using RNeasy kits (Qiagen, Les Ulis, France). The concentration of RNA was quantified by spectrophotometry (SmartSpec™ 3000, Biorad, Hercules, CA, USA). Five hundred nanograms of total RNA was reverse transcribed with the Quanti Tec Reverse Transcription (Qiagen Kit) into cDNA. PCR amplification was performed on a Light Cycler (Roche Diagnostics, Switzerland) using Fast-Start™ DNA Master SYBR Green I real-time PCR kit (Roche Molecular Biochemicals, Switzerland). The expression of the genes was normalized to the expression of human cyclophilin B (CPB) (Qiagen; 5′tgtggtgtttggcaaagttc3′; 3′gtttatcccggctgtctgtc5′). The list of primers (Qiagen) is as follows: BMP2 (5′ccaccatgaagaatctttgga3′; 3′gagttggctgttgcaggttt5′), RUNX2 (5′gtggacgaggcaagagttt3′; 3′tggggtctgtaatctgactc5′), DKK-1 (5′ccttggatgggtattccaga3′; 3′tccatgagagccttttctcc5′), RANKL (5′accagcatcaaaatcccagg3′; 3′ccccaaagtatgttgcatcc5′), Shn 3 (5′ccctg agccataaccctgaa 3′; 3′gtaggacttggcgttggtgt 5′), TNF-α receptor type II (TNFRII) (5′ ggtctccttgctgctgtttc3′; 3′ccggagattctcaaatccaa5′), and TNF-α receptor type I (TNFRI) (5′ accaagtgccacaaaggaac 3′; 3′ctgcaattgaagcactggaa 5′).

UBB⁺¹ expressing cells and control cells were grown in liquid selective medium at 30°C. Cell samples were taken on exponential phase (OD₆₀₀ of 1.0), days 1 and 3 of incubation. Total RNA was extracted using the RNeasy^® kit (QIAGEN, Sweden) following manufacturer’s instructions. The synthesis of first strand cDNA was performed using 1 μg of total RNA and following the QuantiTec Reverse Transcription (QIAGEN, Sweden) manufacturer’s protocol. The primers were designed using the Primer3 software and synthesized by Sigma-Aldrich Company (Sigma-Aldrich, Sweden). The DyNAmo™ ColorFlash SYBR^® Green qPCR Kit (Thermo Fisher Scientific, Sweden) and the Mx3005P Agilent Technologies equipment (Agilent Technologies, Sweden) were used for the QPCR assay. DAL81 snd SPC10 were used as reference genes to normalize the RNA levels. The relative transcription levels were calculated using the ΔΔCt method. Results are from three independent experiments, performed duplicate per experiment. The data analysis was performed using the MX pro QPCR software.