The largest database of trusted experimental protocols

Pd168393

Manufactured by Merck Group
Sourced in United States, United Kingdom, Germany

PD168393 is a chemical compound manufactured by Merck Group for use in various laboratory applications. It is a small molecule with a specific chemical structure and properties. The core function of PD168393 is to serve as a research tool for scientific investigations, but its intended use should not be extrapolated beyond the factual information provided.

Automatically generated - may contain errors

9 protocols using pd168393

1

Inhibitors for Zebrafish Embryo Development

Check if the same lab product or an alternative is used in the 5 most similar protocols
LY294002 (TocrisBioscience, Bristol, UK), SB431542, and PD168393 (Sigma-Aldrich, Germany) were dissolved in DMSO, and solutions were further diluted in E3 embryo medium to concentrations of 25 μM LY294002, 75 μM SB431542, and 10 μM PD168393. Embryos were incubated in inhibitor solution starting from 10 hours post fertilization (hpf) (LY29400 and PD168393) or 3 hpf (SB431542).
+ Open protocol
+ Expand
2

BrdU Incorporation and DNA Damage Assays in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
30–40 larvae were dechorionated and incubated in 6-well plates at 29°C in either 10 µM solution of BrdU in 2% DMSO in E3 or only 2% DMSO in E3 for 2 hours. They were given three 5 minutes washes with E3, followed by PFA fixation and methanol up-gradation. After downgrading to PBS and prior to processing for immunostaining, the fixed larvae were treated with 4N HCl for 20 minutes at room temperature and processed for immunostainings.
For Hydroxyurea treatment, working concentration of 50 mM was prepared using E3 without methylene blue. In case of combined treatment, 30 mM hydroxyurea and 150 uM aphidicolin was used. Final concentration of DMSO was adjusted to −0.05% v/v to increase the permeability of Aphidicolin. Both Hydroxyurea and combined treatment of Hydroxyurea+Aphidicolin were done at 24hpf on dechorionated embryos. The 1 mM stock of PD168393 (Merck Millipore 513033) was prepared in DMSO and used at 10 µM final concentration in 1% DMSO in E3 starting from 18hpf.
The TUNEL staining was performed using Promega Kit as per the manufacturer's instructions. Briefly, the embryos at 48hpf were fixed in 4%PFA, washed in PBT (0.1 m phosphate buffer and 0.8% triton X-100), incubated with TUNEL reaction mixture at 37°C followed by washes, DAPI staining and mounted in Glycerol for imaging.
+ Open protocol
+ Expand
3

Inhibition of Cell Contractility

Check if the same lab product or an alternative is used in the 5 most similar protocols
T84 cells were seeded in a 35-mm plastic dish on day 0. On day 1, 10 μM of Y-27632 (Sigma-Aldrich Co. LLC), 25 μM of blebbistatin (Enzo Life Sciences, Inc., Farmingdale, NY, USA), 1 μM of PD168393 (EMD Millipore, Billerica, MA, USA) or dimethyl sulfoxide (Wako Pure Chemical Industries, Ltd, Osaka, Japan) was added. On day 4, the cell lysate was extracted for western blotting.
+ Open protocol
+ Expand
4

Plasmids for Pseudovirus Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following plasmids were used to make PsVs: p16shell.L2-3xFLAG-thrombin-HA (Zhang et al., 2014 (link)); pV18cap (Campos et al., 2012 (link)) kindly provided by Samuel Campos; pV2-31LLh (Smith et al., 2007 (link)) kindly provided by Michelle Ozbun; p2shell (Cerqueira et al., 2017 (link)), p5shell (Buck et al., 2006 (link)), pBPVshell (Buck et al., 2004 (link)), pCRPVshell (Roberts et al., 2007 (link)), and pMushell (Handisurya et al., 2012 (link)), all kindly provided by Christopher Buck. They carry bicistronic sequences encoding the L1 and L2 capsid proteins from HPV-16, HPV-18, HPV-31, HPV-2, HPV-5, BPV-1, SfPV-1, and MmuPV-1 respectively. The plasmid pGL3 luci, which carries the firefly[108mm][-12mm] Q10 luciferase gene, was purchased from Promega.
Mouse anti-MICAL-L1 (Novus Biologicals), rabbit anti-α-actinin (Santa Cruz), mouse anti-VAP-B (Abcam) and mouse anti-pERK1/2 antibody (Cell Signaling) were used for immunofluorescence or western blotting. The EGFR-specific inhibitor PD168393 was purchased from Sigma-Aldrich.
+ Open protocol
+ Expand
5

Knockdown and Inhibition of Zebrafish Development

Check if the same lab product or an alternative is used in the 5 most similar protocols
For foxd3 (NM_131290) knock down experiments, morpholino antisense oligonucleotides (Gene Tools) against the ATG site were used (MOfoxd3): 5’ TGCTGCTGGAGCAACCCAAGGTAAG 3’. As a control, a Control morpholino (MOctl) from Gene Tools was used: 5’ AATCACAAGCAGTGCAAGCATGATG 3’. Two-three nl of each morpholino at 500 µM concentration was injected in one-cell stage embryos with a Femto. Jet from Eppendorf. No side effect was observed. For Nrg1 signalling inhibition, AG1478 (Sigma), and PD168393 (Sigma) were diluted directly in fish water at 10 µM, and the treatment was renewed every 24 h after amputation.
+ Open protocol
+ Expand
6

Recombinant NRG1 Preparation and Antibody Use

Check if the same lab product or an alternative is used in the 5 most similar protocols
The recombinant NRG1 was prepared as described previously (Huang et al., 2000 (link); Woo et al., 2007 (link)). 1NM-PP1 was purchased from EMD Milipore (product number 529581). PD168393 was purchased from Sigma-Aldrich (produce number PZ0285). The rabbit anti-phosphorylated-ErbB4 (Tyrosine 1248) antibody was from Cell Signaling (product number 4757S). Dr. Cary Lai kindly supplied the rabbit anti- pan-ErbB4 polyclonal antibody (0618). The rabbit anti-PV antibody was from Swant (product number PV25). The mouse anti-NeuN antibody was from Neuromics (product number MO22122).
+ Open protocol
+ Expand
7

Zebrafish Injury Model with PD168393

Check if the same lab product or an alternative is used in the 5 most similar protocols
Larvae were treated with 3.75 μM PD168393 (Sigma, catalog #: 194,423-15-9) in zebrafish water containing 0.2% DMSO immediately after injury and until 5 dpf/48 hpi. Control larvae were incubated in zebrafish water containing 0.2% DMSO for the same period of time. Fish were then rinsed three times for 5 min in fresh zebrafish water and let to recover until 6 dpf/72 hpi before being anesthetized and mounted for in vivo confocal imaging.
+ Open protocol
+ Expand
8

Antibody Staining Techniques for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following primary antibodies were used: rabbit anti-HB-EGF (antibodies-online), mouse anti-Myc (9B11; Cell Signaling Technologies), rabbit anti-EGF (antibodies-online), rabbit antipro-EGF (against aa 700-800; Novus Biologicals, R&D Systems Europe Ltd, England), rabbit anti-APP C-Terminal (clone CT695; Invitrogen), mouse anti-APP N-terminal (clone 22C11; Chemicon), mouse anti-APP residues 1-16 of Abeta (clone 6E10), rabbit anti-ERK1/2 (Millipore, Merck Life Science S.L.U., Portugal), rabbit anti-phosphorylated ERK1/2 (Thr202/Tyr204 Erk1 and Thr185/Tyr187 Erk2; Millipore), anti-acetylated alpha-tubulin (Sigma-Aldrich, Química S.A., Portugal), mouse anti-βIII Tubulin (Sigma-Aldrich). HRPconjugated anti-mouse and anti-rabbit secondary antibodies were from GE-Healthcare.
Secondary antibodies Alexa Fluor 405 goat anti-rabbit, Alexa Fluor 594 goat anti-rabbit or anti-mouse, and Alexa Fluor 488 goat anti-mouse were from Life Technologies. Human recombinant EGF was from Cell Signaling and was used at a 100 ng/mL working concentration (WC). The EGFR inhibitor drug PD 168393 (Sigma-Aldrich) was used at 10 µM WC. Texas Red-conjugated Transferrin was from Molecular Probes.
+ Open protocol
+ Expand
9

Antibody Staining Techniques for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following primary antibodies were used: rabbit anti-HB-EGF (antibodies-online), mouse anti-Myc (9B11; Cell Signaling Technologies), rabbit anti-EGF (antibodies-online), rabbit antipro-EGF (against aa 700-800; Novus Biologicals, R&D Systems Europe Ltd, England), rabbit anti-APP C-Terminal (clone CT695; Invitrogen), mouse anti-APP N-terminal (clone 22C11; Chemicon), mouse anti-APP residues 1-16 of Abeta (clone 6E10), rabbit anti-ERK1/2 (Millipore, Merck Life Science S.L.U., Portugal), rabbit anti-phosphorylated ERK1/2 (Thr202/Tyr204 Erk1 and Thr185/Tyr187 Erk2; Millipore), anti-acetylated alpha-tubulin (Sigma-Aldrich, Química S.A., Portugal), mouse anti-βIII Tubulin (Sigma-Aldrich). HRPconjugated anti-mouse and anti-rabbit secondary antibodies were from GE-Healthcare.
Secondary antibodies Alexa Fluor 405 goat anti-rabbit, Alexa Fluor 594 goat anti-rabbit or anti-mouse, and Alexa Fluor 488 goat anti-mouse were from Life Technologies. Human recombinant EGF was from Cell Signaling and was used at a 100 ng/mL working concentration (WC). The EGFR inhibitor drug PD 168393 (Sigma-Aldrich) was used at 10 µM WC. Texas Red-conjugated Transferrin was from Molecular Probes.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!