Human recombinant TNFα protein was purchased from PeproTech (Rocky Hill, NJ, USA). Src-inhibitor saracatinib, JAK-inhibitor tofacitinib, mitogen-activated protein kinase-inhibitor SB203580, STAT3-inhibitor S3I-201, p65-inhibitor JSH-23, IKK-inhibitors TPCA-1 and IKK-16 were perchased from Selleckchem (Houston, TX, USA), JAK-inhibitor PDTC was perchased from Abcam (Cambridge, MA, USA). Antibody against HK2, phospho-IKKα/β (Ser176/180) and phospho-IKKε (Ser172) were purchased from Cell Signaling Techonology (Beverly, MA, USA), antibody against YAP was purchased from NOVUS Biologicals (Littleton, CO, USA), antibody against CD68 was pursed from Abcam, antibody against p65 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against β-actin, GFP, Myc, Flag, HA and TEAD4 were purchased from Sigma-Aldrich. Antibody against TNFR1, IKKα, IKKβ and IKKε were purchased from Abclonal Technology (Wuhan, China). Antibody against pan-phosphorylated serine/threonine was purchased from BD Biosciences (San Jose, CA, USA).
Tead4
Manufactured by Merck Group
TEAD4 is a laboratory equipment product manufactured by Merck Group. It is a molecular biology tool designed for the detection and analysis of the TEAD4 protein, which plays a key role in cellular processes. The core function of TEAD4 is to facilitate the study of gene expression and cellular signaling pathways that involve this important transcription factor.
Automatically generated - may contain errors
Lab products found in correlation
Recombinant human tnfα protein, by Thermo Fisher Scientific (1 mentions)
Flag tag (flag), by Merck Group (1 mentions)
Jsh 23, by Selleck Chemicals (1 mentions)
Antibodies against β actin, by Merck Group (1 mentions)
Tofacitinib, by Selleck Chemicals (1 mentions)
Saracatinib, by Selleck Chemicals (1 mentions)
Antibody against p65, by Santa Cruz Biotechnology (1 mentions)
Tpca 1, by Selleck Chemicals (1 mentions)
Ikk 16, by Selleck Chemicals (1 mentions)
Antibody against cd68, by Abcam (1 mentions)
Sb203580, by Selleck Chemicals (1 mentions)
Phospho s6 ribosomal protein, by Cell Signaling Technology (1 mentions)
S6 ribosomal protein, by Cell Signaling Technology (1 mentions)
Normal mouse igg, by Merck Group (1 mentions)
Normal rabbit igg, by Merck Group (1 mentions)
Simplechip enzymatic chromatin ip kit magnetic beads, by Cell Signaling Technology (1 mentions)
Tfap2c, by Merck Group (1 mentions)
Genjet transfection reagent, by SignaGen (1 mentions)
Rcor1, by Merck Group (1 mentions)
Gata2, by Merck Group (1 mentions)
4 protocols using tead4
1
TNFα Signaling Pathway Regulation
2
Quantitative Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot analyses were conducted as described previously [32 (link)]. Densitometry analysis of the Western blotting bands was performed using ImageJ software. The quantified results were calculated from three independent experiments. The primary antibodies were used as follows: YAP (NOVUS, NB110-58308), TEAD4 (Sigma, WH0007004M1), microtubule-associated protein1 light chain 3 (LC3) (Cell Signaling, #2775), p62 (MBL, pm045), S6 ribosomal protein (Cell Signaling, #2217), and phospho-S6 ribosomal protein (ser235/236) (Cell Signaling, #2211).
3
ChIP Assay for Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using the Simple ChIP Enzymatic Chromatin IP Kit (Magnetic Beads) from Cell Signaling Technology according to the manufacturer’s protocol. MCF7 cells (4 × 106) were harvested for ChIP and formaldehyde cross-linked protein-DNA complexes were precipitated with antibodies against YAP (Cell Signaling Technology), TEAD4 (Sigma-Aldrich) and p65 (Santa Cruz Biotechnology). As negative control, normal mouse IgG and normal rabbit IgG (Merck & Millipore) were utilized. Purified DNA fragments were amplified by real-time PCR with the appropriate primers. Sequences of the real-time PCR primer pairs are as follows (all listed in the 5′–3′ direction):
HK2 primer: F—CGTGTAGGAGACGAGCGGTTC,
R—GGAGTTCCTCTGCCCCTTTC;
IL-6 primer: F—CCACCCTCACCCTCCAACAAA,
R—GAGCCTCAGACATCTCCAGTCCTAT;
CCL2 primer: F—CAGGCTTGTGCCGAGATGTT,
R—GGGAAGGTGAAGGGTATGAA.
HK2 primer: F—CGTGTAGGAGACGAGCGGTTC,
R—GGAGTTCCTCTGCCCCTTTC;
IL-6 primer: F—CCACCCTCACCCTCCAACAAA,
R—GAGCCTCAGACATCTCCAGTCCTAT;
CCL2 primer: F—CAGGCTTGTGCCGAGATGTT,
R—GGGAAGGTGAAGGGTATGAA.
4
Lentiviral Knockdown of Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Short hairpin RNAs (shRNAs) against FOS, GATA2, MAFK, TEAD4, TFAP2C, NCOR2, RCOR1 and ZNF362 were purchased from Sigma-Aldrich (Supplementary Table S1 ). A total of 7.3 × 106 HEK293T cells were transfected with 2.5 μg of the pLKO construct with a specific shRNA, 1.7 μg of Δ8.9 and 0.8 μg of VSVG using 15 μl of a GenJet transfection reagent (SignaGen) to generate lentiviruses expressing a specific shRNA. After 24 h, the medium was replaced with the TSC medium. After cultivating at 37°C for 24 h, the viral supernatant was collected, filtered with a syringe filter (0.45 μm) and used to infect TSCs. To knock down individual TFs, 2.5 × 105 TSCs were infected with pLKO-shRNA viral particles in a well of a 12-well plate. Infected cells were incubated overnight, and the medium was replaced with fresh TSC medium supplemented with puromycin to select out the infected cells. To determine the KD efficiency of each TF and profile global gene expression, we harvested the cells after 3 days of selection to get complete KD of an individual TF.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!